ID: 1088059138

View in Genome Browser
Species Human (GRCh38)
Location 11:105624371-105624393
Sequence GTGAACTAGCAAGCACACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088059134_1088059138 -5 Left 1088059134 11:105624353-105624375 CCCTTTTGGGAAGCCCAGGTGAA 0: 1
1: 0
2: 2
3: 41
4: 411
Right 1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1088059135_1088059138 -6 Left 1088059135 11:105624354-105624376 CCTTTTGGGAAGCCCAGGTGAAC 0: 1
1: 0
2: 3
3: 67
4: 627
Right 1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1088059130_1088059138 17 Left 1088059130 11:105624331-105624353 CCACTTTCAAAGTAGGAGAAAGC 0: 1
1: 0
2: 0
3: 10
4: 230
Right 1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088059138 Original CRISPR GTGAACTAGCAAGCACACTC AGG Intronic
912084693 1:105984424-105984446 CTAAACTAACAAGGACACTCTGG - Intergenic
912600468 1:110927400-110927422 GTGAGCGAGCAAGAACACGCTGG + Intergenic
922017650 1:221667606-221667628 CTGAACTAGCATGCACAGTGGGG - Intergenic
923359525 1:233196829-233196851 GTGATCTAGCAATCTCACTCAGG + Intronic
1071913876 10:90268296-90268318 GTGAGCTTGCAAGCAGATTCTGG - Intergenic
1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG + Intronic
1089531057 11:119129763-119129785 GTGAACTATCAACCACATTTTGG - Intronic
1090609453 11:128457150-128457172 GTGAACTAGAGGTCACACTCAGG - Intergenic
1092854230 12:12657646-12657668 GTGAAATTGCCAGCACTCTCTGG + Intergenic
1097841321 12:64324425-64324447 GTGATCAAGCAAGAACTCTCTGG + Intronic
1101961472 12:109253985-109254007 CTGAACCGGGAAGCACACTCAGG + Intronic
1104564332 12:129866746-129866768 ATGATCTAGCAATCCCACTCTGG + Intronic
1106047413 13:26155915-26155937 GTGACCCAGGAAGCTCACTCTGG - Intronic
1106185520 13:27406534-27406556 GTGAAGTAGCACACACACTCTGG + Intergenic
1106286643 13:28323774-28323796 GTGAAGCACCAAGCACACTGAGG - Intronic
1115088979 14:29551239-29551261 GTGAAGCAGCTAGCACACTGAGG + Intergenic
1126318766 15:47399263-47399285 GTGGACTAGAAAGCTCACTGTGG - Intronic
1128842448 15:70861015-70861037 TTGAACCAGCAAACACGCTCTGG + Intronic
1128979431 15:72175713-72175735 GTAAACAGACAAGCACACTCTGG - Intronic
1129535837 15:76313059-76313081 CTGAACTAACAAGCACTCTAAGG + Intergenic
1129723519 15:77890375-77890397 GTTCACTAGCAAGGACACTGAGG + Intergenic
1132486236 16:193060-193082 GTTAAGTAGCATTCACACTCTGG - Intronic
1135941421 16:26825411-26825433 GAGAGCTATCAAGTACACTCAGG - Intergenic
1151292332 17:73159548-73159570 GTGGTCCAGGAAGCACACTCTGG + Intergenic
1161573877 19:5044973-5044995 GTGAATGAGCAGGCACACTGTGG - Intronic
1161629615 19:5346215-5346237 GTGAGCTGGCACGCACACTGAGG + Intergenic
929252432 2:39774048-39774070 GTTACCTAACAGGCACACTCTGG - Intronic
929371776 2:41233933-41233955 GTGAAATAGAAAGAACACTTGGG - Intergenic
938692442 2:133804718-133804740 GAGAACTAACAAATACACTCGGG - Intergenic
938693705 2:133815823-133815845 GTGAACTTGCATGCACCCTGAGG + Intergenic
944516446 2:200516604-200516626 GAGACCTAGCAAACACACTGGGG + Intronic
944933362 2:204543549-204543571 GTGAACCATAAAGAACACTCCGG - Intergenic
947305058 2:228736500-228736522 GTGAACTAGAAAATACTCTCAGG + Intergenic
947443522 2:230143859-230143881 GTTCCCTAGCAAGCAGACTCAGG - Intergenic
948634261 2:239324554-239324576 GTGCAGCAGCCAGCACACTCAGG + Intronic
1169189274 20:3647130-3647152 GAGAACTAGGAATGACACTCAGG + Exonic
1170702610 20:18716487-18716509 GTGAGTTAGCAAGCAGACCCTGG - Intronic
1179326946 21:40356144-40356166 ATGATCTAGCAATCCCACTCTGG - Intronic
957305730 3:78456385-78456407 GTGAACTAGAAACCTCACCCTGG - Intergenic
958146101 3:89627539-89627561 ATGATCCAGCAATCACACTCTGG + Intergenic
959234715 3:103705291-103705313 GAGAAAAAGCAAGCACACTTTGG - Intergenic
959604187 3:108224043-108224065 GTTAACTAACAAGCAAACTGGGG + Intergenic
963112702 3:141700328-141700350 GCGAACTAGGAAGCACAGTTGGG + Intergenic
964321043 3:155497557-155497579 CTGAACTAGGAAGCACACTTGGG - Intronic
966624706 3:182003377-182003399 GTGTAATAGCAAGAACATTCAGG + Intergenic
972027060 4:34394714-34394736 GTGATCTAGCAAGTCCACTTTGG + Intergenic
974665551 4:64956768-64956790 GTGAACTAACCAGCACTCTCTGG + Intergenic
981336534 4:143574558-143574580 GAACACTAGAAAGCACACTCAGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992547188 5:77824656-77824678 GTGACCTAGAGAGCACCCTCAGG - Intronic
998104038 5:139457048-139457070 GTGAATGAGGAAGCACACTCGGG + Intronic
998607820 5:143653533-143653555 GAGAACTGGCCTGCACACTCAGG + Intergenic
998655949 5:144179957-144179979 GTGAACTTGCAAGCACCCACAGG - Intronic
999795466 5:154985352-154985374 GGGAACTAGCAAGCAAAAGCAGG + Intergenic
1000646527 5:163766594-163766616 TTGAAGTAGGAAGCAGACTCTGG - Intergenic
1000929009 5:167229722-167229744 GTGAACCTGCAAGCTCAGTCTGG - Intergenic
1004113349 6:12743136-12743158 GTGAACTAACAAGTAATCTCTGG - Intronic
1004911931 6:20293985-20294007 TAGAACAAGCAGGCACACTCTGG - Intergenic
1008603612 6:53119256-53119278 GTGAAGAAACAAGAACACTCAGG + Intergenic
1009609632 6:65924000-65924022 GTGAACCAGCAAATACTCTCTGG + Intergenic
1010830847 6:80526973-80526995 GTGAAATAGCAAGAATACTGAGG - Intergenic
1010943385 6:81946712-81946734 GTGATCCATCAAACACACTCAGG + Intergenic
1015803004 6:137079657-137079679 GTAAACTAGCACAAACACTCTGG - Intergenic
1022299670 7:29091345-29091367 GTTAACTAGCAAACACCCTGAGG - Intronic
1023442288 7:40196670-40196692 GTGCACTAGCCACCACACCCGGG + Intronic
1025090115 7:56055379-56055401 GGGAACTATAAAGCACACTTGGG - Intronic
1025832589 7:65066013-65066035 GGGAACTATAAAGCACACTTGGG - Intergenic
1025902362 7:65755540-65755562 GGGAACTATAAAGCACACTTGGG - Intergenic
1026300924 7:69097336-69097358 GTGATATAGTAAGCACACTGTGG - Intergenic
1030861525 7:114637483-114637505 GTGTACTGGCAAACATACTCTGG - Intronic
1033865991 7:145691275-145691297 GTGAACCAACCAGCAAACTCTGG + Intergenic
1038625155 8:29185261-29185283 GTTATCAAGCAAGTACACTCTGG + Intronic
1039751054 8:40479102-40479124 GTGAAGTAGCAACCTCACTCAGG - Intergenic
1040288631 8:46113048-46113070 GGGAACAAGCAAGGACACTGAGG - Intergenic
1040968935 8:53113178-53113200 GTGACCGAGCATGCACACTTGGG - Intergenic
1056496125 9:87157125-87157147 GGGGACTAGCAAGTACCCTCTGG + Exonic
1058854200 9:109044201-109044223 GAAAAGTAGCAAGCACAATCTGG - Intronic
1189616638 X:42790454-42790476 GTGAACCAACCAGCAAACTCTGG - Intergenic
1196574108 X:117298834-117298856 GTAAACTAGGAAGTACATTCTGG - Intergenic
1198317408 X:135482487-135482509 GTGAACAAGCCAGCACACTCTGG + Intergenic
1199846015 X:151693867-151693889 GTGAAATAGCAAGCAAGCTAGGG + Intergenic