ID: 1088063264

View in Genome Browser
Species Human (GRCh38)
Location 11:105683138-105683160
Sequence ATGTATACAGAGAAAAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 596}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088063264_1088063265 1 Left 1088063264 11:105683138-105683160 CCATGATTTTTCTCTGTATACAT 0: 1
1: 0
2: 3
3: 59
4: 596
Right 1088063265 11:105683162-105683184 AAAATGTGTGTTACTTTTTTAGG 0: 1
1: 0
2: 4
3: 68
4: 681

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088063264 Original CRISPR ATGTATACAGAGAAAAATCA TGG (reversed) Intronic
901270311 1:7947924-7947946 AGGTGCACAGATAAAAATCAGGG - Intergenic
903687712 1:25144141-25144163 ATGTGTAATGAAAAAAATCAGGG - Intergenic
904585285 1:31576628-31576650 GTGTAGACAGAGAAGAAACAGGG + Intronic
905253013 1:36661812-36661834 ACATATACAGAGAAAGATCCAGG - Intergenic
906359484 1:45140973-45140995 GTGCATACAGAGAAAGATCCAGG + Intronic
907234813 1:53036790-53036812 ATATATGCAGAGAAAAAAAATGG - Intronic
907950865 1:59182398-59182420 ATTAATACACAGAAAAATTAAGG + Intergenic
908598723 1:65716070-65716092 TTGTATACAGAGAAGGATAAGGG + Intergenic
908704202 1:66932804-66932826 ATGTCTCCAGAGAAAAATGTAGG + Intronic
908801995 1:67889878-67889900 ATGCAGACAGAGGAAAATAATGG + Intergenic
908936168 1:69378709-69378731 ATGTATATAAATAAAAAACAAGG - Intergenic
909085508 1:71165861-71165883 ATATAAACAGAGGACAATCATGG - Intergenic
909278480 1:73719438-73719460 ATTTATACAGATAGAAATCCAGG + Intergenic
909644746 1:77904646-77904668 ATGCGTACAGAGGAAAATCAGGG + Intronic
909700698 1:78519103-78519125 ATTGATAGAGACAAAAATCAAGG - Intronic
909751536 1:79166856-79166878 AGCTATTCAGAGAAAAAGCATGG - Intergenic
909754263 1:79203797-79203819 ATGTCTAAAGAGAAGGATCAGGG + Intergenic
910562851 1:88611013-88611035 AAGGATAAAGAGAAAATTCAGGG - Intergenic
911080493 1:93924613-93924635 ATATCTATACAGAAAAATCAAGG - Intergenic
911608095 1:99931269-99931291 ATGTAAAAAGAGAAAAATAACGG + Intergenic
911636772 1:100244646-100244668 ATGTATATATAGGAAAAACACGG - Intronic
911851047 1:102821383-102821405 ATGTATAATGAGAAAATTGAGGG + Intergenic
912852203 1:113136791-113136813 ATGTATAAAGAACAAAACCATGG - Intergenic
913094785 1:115506157-115506179 ATGTGTAGAGAGAAGAGTCAGGG + Intergenic
913301710 1:117377280-117377302 ATGTAGAGAGAAAAAAATCTAGG - Intronic
913989550 1:143598107-143598129 ATGTATTGAGAGTAAGATCAGGG + Intergenic
915779149 1:158526587-158526609 ATGTAAACCAAAAAAAATCAGGG + Intergenic
915790838 1:158669227-158669249 ATTTATACAGTTAAATATCAAGG - Intronic
915812255 1:158926072-158926094 ATGTATTGAAAGAAAAAACATGG - Intergenic
915868722 1:159534663-159534685 ATGTAAGCAGAGAGAAATAAAGG + Intergenic
916292502 1:163181924-163181946 ATTTTTACATAGAAAAATGAAGG - Intronic
916329604 1:163599927-163599949 ATTTATACAGACAGAAATCAAGG + Intergenic
916386078 1:164272113-164272135 ATTTATACAGACAGAAATCCAGG - Intergenic
917101360 1:171449074-171449096 ATGTTTACAGAAAAAACCCACGG - Intergenic
917261610 1:173175490-173175512 AGGCATAGAGAAAAAAATCAAGG - Intergenic
917464543 1:175264080-175264102 AAGTATACAGAAAAAACTAAAGG + Intergenic
917465129 1:175269554-175269576 TTGTATATAAAGACAAATCATGG - Intergenic
917982304 1:180277797-180277819 ATGAATACTGTGAAACATCAGGG + Exonic
918616867 1:186554049-186554071 ATGCATGGAGAGAAAAATCTAGG + Intergenic
918695201 1:187537486-187537508 ATTAATATAGAGAAAAAGCAGGG - Intergenic
918771106 1:188560785-188560807 ATGTATAAAGAGAAACTCCAGGG - Intergenic
918908577 1:190532790-190532812 ATGTATAAAGAGAAACTCCAAGG - Intergenic
919321952 1:196054162-196054184 ATGTACAAATAGAAAAATTAAGG - Intergenic
919344488 1:196357828-196357850 AAGTATAAAGAGAAATATAAAGG - Intronic
920243576 1:204571754-204571776 ATGTTTAAAGGTAAAAATCAAGG - Intergenic
921754455 1:218837715-218837737 ATGTGTACAGTGAGAAACCATGG + Intergenic
922501981 1:226103980-226104002 ATCTAAACAGAGAAAAAGTATGG - Intergenic
923601706 1:235409332-235409354 ATGTCTAAAGAGAAAAATGTTGG - Intronic
924162675 1:241249861-241249883 ATTTATACAGAAAAAAATTTTGG + Intronic
924583221 1:245339863-245339885 ATGTATATAAAATAAAATCAAGG - Intronic
924641916 1:245841966-245841988 ATGTAAACATAGAAAAAATAGGG - Intronic
1062979431 10:1709705-1709727 ATCTATACAGAGAGAAAGCATGG - Intronic
1063351961 10:5364332-5364354 AGGTATCCAGAGAAAAATGCAGG + Intergenic
1063936116 10:11080262-11080284 ATTTAAACAAAGAAAAAGCAAGG - Intronic
1064585747 10:16837798-16837820 ATGAATACAGGAAACAATCAAGG - Intronic
1064617522 10:17176799-17176821 CTGTATACTAAGAAATATCAAGG - Intronic
1064897255 10:20251780-20251802 ATGTATACTAAGAAAAATTAAGG - Intronic
1065162530 10:22937851-22937873 ATGGAGACAGAGAAACAGCATGG + Intronic
1066182604 10:32977952-32977974 CTGTCTACAGTGAAAGATCAGGG - Intronic
1066564305 10:36704884-36704906 ATGTATATTAAGAATAATCATGG + Intergenic
1066578951 10:36859070-36859092 ATGGATACAGAGAGACATGAAGG + Intergenic
1066641376 10:37557608-37557630 ATGCATCCTGAGAAAAGTCATGG + Intergenic
1066676159 10:37889663-37889685 ATGTATACAAAGATATATCACGG - Intergenic
1066695633 10:38075370-38075392 TTGAATACAGAGAAGAAACATGG + Intergenic
1067323511 10:45244703-45244725 ATGAATACAGGAAACAATCAAGG - Intergenic
1067382913 10:45791684-45791706 ATGTATACATGCTAAAATCATGG + Intronic
1067859783 10:49833870-49833892 ATGTTCCCAGAGAAAAACCAAGG + Intronic
1068170970 10:53394064-53394086 ATATATTCTCAGAAAAATCATGG + Intergenic
1068606159 10:59007534-59007556 ATGTGTAAAGAGATAAATAAAGG + Intergenic
1068718383 10:60214252-60214274 ATGTATAAAAGCAAAAATCAGGG - Intronic
1068839702 10:61596842-61596864 ATATATAGAGATAAAACTCAAGG - Intergenic
1068844220 10:61653159-61653181 ATGTATGAAGAGCAAAAACATGG + Intergenic
1069127447 10:64654066-64654088 ATGTTGACTGAGCAAAATCAGGG - Intergenic
1069215912 10:65820762-65820784 ATGTATACAGAACATAATCAGGG - Intergenic
1069293441 10:66812839-66812861 ATGTATCCAGTGAAAAATTGTGG - Intronic
1070018333 10:72557449-72557471 GTGGATACAGTGAAAAATCAAGG + Intronic
1071252917 10:83839153-83839175 ATTTATACAAAAAAAAGTCAAGG + Intergenic
1072414829 10:95238340-95238362 ATGTAAAATGAGAAAAATCAGGG - Intronic
1073602116 10:104856348-104856370 ATATATAGAGAGAAAGATAAAGG + Intronic
1073602127 10:104856877-104856899 ATATATAGAGAGAAAGATGAGGG + Intronic
1073845827 10:107553126-107553148 ATGGATACTGACAAAAATAAAGG - Intergenic
1074185277 10:111095824-111095846 ATGAATCCAGTGAAAAATAAAGG + Intergenic
1074485171 10:113869755-113869777 ATGTATACAGATTTAACTCATGG + Intronic
1074685729 10:115960916-115960938 ATAAAGACAGAGAAAGATCAAGG + Intergenic
1075141318 10:119839149-119839171 AACTTTTCAGAGAAAAATCAAGG + Intronic
1075432142 10:122394767-122394789 GTGAAGAGAGAGAAAAATCAGGG - Intronic
1075598780 10:123751855-123751877 ATTTATAGAGGGGAAAATCAAGG + Intronic
1076117824 10:127912909-127912931 ATTCAGACAGAGTAAAATCATGG - Intronic
1078705136 11:13736466-13736488 ATGTCTTCAAAGAAAAATCCTGG - Intergenic
1079054231 11:17191582-17191604 AAGGATACAGATTAAAATCAAGG - Intronic
1079170326 11:18088032-18088054 ATGTTTACACAGAAACATGAAGG + Intronic
1079622863 11:22575848-22575870 ATGGATAGAGAGCAAAGTCATGG + Intergenic
1079630848 11:22673036-22673058 ATGTTTTCAGAGAAAATTTATGG + Intronic
1079820453 11:25120922-25120944 ATAAATACAGAGAAAATTAATGG - Intergenic
1080216197 11:29843963-29843985 ATATATCCTGAGATAAATCAGGG + Intergenic
1080379128 11:31749237-31749259 ATGGAGGCAGAGAAAAGTCAGGG + Intronic
1080964593 11:37199553-37199575 ATGGATACAGACAGAAATCAAGG + Intergenic
1081261484 11:40966698-40966720 ATCAATGAAGAGAAAAATCAAGG - Intronic
1081347900 11:42012828-42012850 AGGAACACAGAGAACAATCAGGG + Intergenic
1082172893 11:49027271-49027293 ATGTACAAAGAGGAAAATGAGGG + Intergenic
1082837952 11:57665410-57665432 AAGTATCCAGAGTAAAATCTAGG - Intergenic
1086469321 11:87089737-87089759 AGTTATACTGAGAAAAATTAGGG - Intronic
1087025978 11:93650254-93650276 AGGTAGACTCAGAAAAATCAAGG + Intergenic
1087296653 11:96384993-96385015 AGGGATACATAGAAAAATCATGG + Intronic
1087711545 11:101559303-101559325 ATGAATACAGTGTAAAATTAGGG - Intronic
1087905450 11:103691274-103691296 ATGTAGACAGAGATTAATAAGGG - Intergenic
1088063264 11:105683138-105683160 ATGTATACAGAGAAAAATCATGG - Intronic
1089105876 11:116004714-116004736 AGGTATACAGAGTGAAATAAAGG - Intergenic
1090173595 11:124626626-124626648 ATATATAGAGAGGAGAATCAGGG + Intronic
1090203476 11:124872204-124872226 ATGTATTCACAAAAACATCAGGG - Intronic
1090541669 11:127712724-127712746 ATGTATACTGACAAAAATCCAGG - Intergenic
1091178984 11:133586380-133586402 AAGTAATCAGAGAAAAATAATGG + Intergenic
1091548018 12:1517393-1517415 AGGAAAACAGAGAAAAATGAAGG + Intergenic
1092391020 12:8079430-8079452 ATTTATATAAAGAAAAAACATGG + Intergenic
1092741552 12:11635429-11635451 AAATAAAGAGAGAAAAATCAAGG + Intergenic
1093133805 12:15424605-15424627 ATGTATACACAAACAAATAATGG + Intronic
1093152300 12:15636962-15636984 ATTAATACAGAGAAAAACTATGG + Intronic
1093440044 12:19184220-19184242 ATTTATACAGCAAAAAGTCAGGG - Intronic
1095048342 12:37534513-37534535 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1095164923 12:38960619-38960641 ATCTATACTGAGAGAAGTCATGG - Intergenic
1095453669 12:42359422-42359444 ATTTTTACAAAGAAAAAGCAGGG + Intronic
1095535530 12:43241763-43241785 TTGTATACAGTGAAAGATAAGGG + Intergenic
1095907734 12:47394852-47394874 AAGTGTAGAGAGAAAAATCAAGG - Intergenic
1096438217 12:51614095-51614117 AAGTAGACAGAAAATAATCAGGG - Intronic
1096922522 12:55102586-55102608 ATATAAAGAGAAAAAAATCAAGG - Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1099101178 12:78442304-78442326 ATGTAGACAATGACAAATCATGG - Intergenic
1099165379 12:79300248-79300270 ATGTTTGCAGAGAAAAATGCTGG - Intronic
1099635003 12:85202604-85202626 TTGTAAACAGAGAAAAATCAGGG - Intronic
1099650120 12:85415899-85415921 ATATAAACTGAGGAAAATCAAGG + Intergenic
1099758072 12:86881134-86881156 ATGTAAAAAGAAAAAAATGATGG + Intergenic
1099995336 12:89771961-89771983 ATTTATACAGACAGAAATCTGGG - Intergenic
1100034183 12:90231110-90231132 ATGTATGCAGAGAAAATTGGCGG - Intergenic
1100908700 12:99333112-99333134 AAGTACACAGAGAAAAGTAAAGG + Intronic
1101098101 12:101364485-101364507 ATGGTTAAAGAGAAAAGTCAGGG + Intronic
1101443718 12:104722349-104722371 AGGTATAAAGAGAAATATGATGG - Intronic
1101474929 12:105036724-105036746 ATGTATGCACAGGAAAAGCATGG - Intronic
1101529509 12:105561272-105561294 TTGTATACAGAGAAAGAAAATGG + Intergenic
1101808473 12:108086562-108086584 ATTTATAGATTGAAAAATCAAGG + Intergenic
1102232275 12:111271336-111271358 AAGTACACAGGGAAAAATCACGG - Intronic
1104137360 12:125953209-125953231 ATGATGACAGAGAAAAATAAGGG - Intergenic
1105253320 13:18720815-18720837 ATGTATAGAGAAAGAAATAAGGG - Intergenic
1105312904 13:19229182-19229204 CTTTAAACAGAGAAAAATCCAGG - Intergenic
1105383542 13:19909839-19909861 ATTTATACAGACAAAAATCTGGG + Intergenic
1105500641 13:20968527-20968549 ATTTTTACAGAGAAAAATGGAGG + Intergenic
1107367361 13:39697166-39697188 AATAATACAGAGAGAAATCAGGG + Intronic
1107924610 13:45246710-45246732 ATTTACACAGAGTAAAATCTAGG - Intronic
1108957088 13:56172862-56172884 ATGTATCCAGTTAAATATCAGGG - Intergenic
1109033698 13:57228567-57228589 TTGAACACAGAGAAAAATCCTGG + Intergenic
1109471323 13:62808703-62808725 ATATTTACAGAAATAAATCAAGG + Intergenic
1109498057 13:63200757-63200779 ATGTACACATAGGCAAATCATGG - Intergenic
1109641233 13:65194376-65194398 AGATATTCAGAGAAAAATAAGGG - Intergenic
1109664048 13:65506442-65506464 ATAAATACAGGGAAATATCAGGG - Intergenic
1109745684 13:66621018-66621040 ATGTATACGAAGATATATCAAGG + Intronic
1110004067 13:70243452-70243474 ATGAATACAAAGAATAGTCAAGG + Intergenic
1110250504 13:73376145-73376167 ATGTATGCAGCAAAAAATCTGGG - Intergenic
1110513937 13:76386356-76386378 ATGTATCAAGAGAAACAGCAAGG + Intergenic
1110517124 13:76427041-76427063 ATGAAGACAGAGATAAACCAAGG - Intergenic
1110681199 13:78314095-78314117 ATGTCTAGAGAAAAAAATCTTGG - Intergenic
1110823671 13:79946444-79946466 ATGAACATATAGAAAAATCAGGG - Intergenic
1111743809 13:92239909-92239931 ATATATATAAAGAAATATCAGGG - Intronic
1112539197 13:100290567-100290589 ATGTATACAAACACAAACCAAGG - Intronic
1112615472 13:101000402-101000424 ATGTATGCAGAGATACTTCATGG + Intergenic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113628064 13:111861102-111861124 ATGTGCTCAGTGAAAAATCATGG + Intergenic
1114213305 14:20634312-20634334 ATGTGTCCAGAGGAAAATAAAGG + Intergenic
1116172019 14:41415336-41415358 ATGTGTCCAGATAATAATCAGGG - Intergenic
1116262572 14:42650432-42650454 ATATATAGAGAGAAAAAGCTGGG + Intergenic
1116410615 14:44618042-44618064 ATATTTACAGAGGAAAACCATGG + Intergenic
1116616963 14:47152246-47152268 AGGTATACAAAGAAAAACCATGG - Intronic
1116846713 14:49871082-49871104 ATTTATACAGAGAATACTGAAGG + Intergenic
1117036699 14:51737645-51737667 ATGTACACAGAAAAAAATAGAGG + Intergenic
1117617321 14:57546731-57546753 ATGTTCAAAGAGAAAAATCAAGG - Intergenic
1118886555 14:69871741-69871763 ATATATAAAGAGAAGAATTAGGG - Intronic
1119043637 14:71297819-71297841 AAGTACACAGAGACAAATCCAGG + Intergenic
1119044226 14:71303513-71303535 ATCTAAAAAGAAAAAAATCATGG + Intergenic
1119108141 14:71943742-71943764 AAGGATGCAGAGAAAAAACATGG - Intronic
1119951272 14:78748246-78748268 ATGTATAAAGTGAGAAATAAAGG + Intronic
1120026239 14:79587630-79587652 ATGTATAAATAGAAAAGCCAAGG + Intronic
1120055701 14:79921472-79921494 ATGTATAAGGAGAAAAAAAATGG + Intergenic
1120128756 14:80780149-80780171 ATTTGTACAGAGAAAAAATATGG + Intronic
1120191270 14:81441919-81441941 AAGGAGACACAGAAAAATCAGGG + Intergenic
1120266329 14:82255443-82255465 ATGTATAAAGATAAATATAAAGG + Intergenic
1120312930 14:82854436-82854458 ATGAATAAAGAAATAAATCATGG - Intergenic
1120356427 14:83440382-83440404 ATGTATTCAGAGAAATATTTTGG + Intergenic
1120416098 14:84220388-84220410 ATTTTTACAGGGAGAAATCAGGG - Intergenic
1120522959 14:85546245-85546267 ATATTTACAGAGAAATACCATGG - Intronic
1121280539 14:92694347-92694369 AGGAAGACAGTGAAAAATCATGG + Intergenic
1124509349 15:30309833-30309855 ATTTATACAGACAAAAATCCAGG + Intergenic
1124734211 15:32228829-32228851 ATTTATACAGACAAAAATCCAGG - Intergenic
1126001526 15:44215119-44215141 ATGTGTAAAGGAAAAAATCAAGG + Intergenic
1127599002 15:60516440-60516462 ATGTATGCAGAAAAAAAATAAGG + Intronic
1129477788 15:75797782-75797804 AAGGATACAGATTAAAATCAGGG + Intergenic
1129556658 15:76517207-76517229 ATGTATATATAGTAAAATCTTGG - Intronic
1130437274 15:83913825-83913847 ATGTACACAAACATAAATCATGG - Intronic
1130730327 15:86485358-86485380 ATATAAGCAGTGAAAAATCATGG - Intronic
1131423137 15:92324230-92324252 AGATAATCAGAGAAAAATCAGGG - Intergenic
1132469698 16:95395-95417 ATATATACAGATAAAAAACCTGG + Intronic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1133839579 16:9395231-9395253 ATGTATAATGATACAAATCAGGG + Intergenic
1133919759 16:10141519-10141541 ATGAATACAGAGAAGAATCAAGG + Intronic
1134455053 16:14389271-14389293 TTTTATACAGACAAAAATCTTGG - Intergenic
1134784109 16:16925356-16925378 ATGTATACGGACATAAATCTAGG - Intergenic
1135092169 16:19525812-19525834 AGGAAGACAGACAAAAATCAAGG + Intronic
1135919552 16:26636670-26636692 ATGTATAAGAAGAAAAGTCAAGG + Intergenic
1137039989 16:35601712-35601734 ATGTATGGACAGAAAAAGCAAGG + Intergenic
1137879255 16:52029806-52029828 AAGTATAAAGAGGAAAATGAGGG + Intronic
1139055861 16:63182779-63182801 ATGTAGAGAGGGAAAAATAATGG - Intergenic
1139060783 16:63248988-63249010 TTGTATAAACAGAAAAAACAAGG + Intergenic
1139677322 16:68533066-68533088 AGGTCAACAGAAAAAAATCAAGG - Intronic
1140561004 16:75981826-75981848 AAGTATACAGATAAATTTCATGG - Intergenic
1141404285 16:83778173-83778195 ATGAACTCAGAGAAAAATGAAGG + Intronic
1141804438 16:86333597-86333619 AGGTATGCAGAGGAATATCATGG + Intergenic
1142044329 16:87915367-87915389 ATGTTTACAAAGGAAAAACAAGG + Intronic
1143341191 17:6212603-6212625 AAATACAAAGAGAAAAATCAGGG - Intergenic
1145365732 17:22265724-22265746 ATGAAAACAAAGGAAAATCAAGG - Intergenic
1145411608 17:22670693-22670715 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1145728347 17:27154201-27154223 ATGAAAGCAGAGGAAAATCAAGG + Intergenic
1145729130 17:27159152-27159174 ATGAATGCAAAGAAAACTCAAGG + Intergenic
1146024464 17:29307633-29307655 ATGTATCAAAAGGAAAATCATGG + Intergenic
1146436426 17:32852849-32852871 ATGTATACAGTGAGAAGTGAAGG - Intronic
1146952717 17:36918088-36918110 ATGAATACAGAGAAAAGAAAAGG - Intergenic
1149379638 17:56080745-56080767 GTGTATACATACAAAAATAAGGG - Intergenic
1150696872 17:67412864-67412886 AAGTATAAAGAGAAATATGAAGG - Intronic
1150967115 17:69983763-69983785 ATGTAGACAGAAAAGAATCAAGG + Intergenic
1150967208 17:69984900-69984922 TTGTATACATAGAAAATTCCAGG + Intergenic
1152480834 17:80551294-80551316 AAGTATAGAGAGAGAAATAAGGG + Intronic
1153473816 18:5474989-5475011 ATGTATAAAAAGAAAAACTAAGG - Intronic
1153535078 18:6093560-6093582 CAGTATACAGTGATAAATCAGGG + Intronic
1154087503 18:11321912-11321934 ATGAAGACAGAGAAAGATCCTGG + Intergenic
1154254815 18:12773312-12773334 GTTTATAGAAAGAAAAATCATGG + Intergenic
1154355039 18:13618611-13618633 ATGGATATAGAGGAAAATCATGG - Intronic
1155542185 18:26880114-26880136 TTGAATAAAGATAAAAATCACGG + Intergenic
1155580508 18:27299871-27299893 ATGAATACAGAGGAGAAACAAGG + Intergenic
1155641970 18:28029008-28029030 ATGTAACCAGGAAAAAATCATGG + Intronic
1156212510 18:34960661-34960683 ATGAATTCAGGGAAAAATCTCGG - Intergenic
1156671934 18:39481246-39481268 ATGTATATATTGAGAAATCAAGG - Intergenic
1156772972 18:40751686-40751708 ATGTATGGGGAGAAAAATAATGG + Intergenic
1157107275 18:44786255-44786277 ATGTACACAGGAAAAAATCTAGG - Intronic
1157756823 18:50226024-50226046 ATAAATACAGAAGAAAATCATGG + Intergenic
1158960664 18:62585122-62585144 ATGTTTCCAGAGAAATATCCAGG + Intronic
1159299816 18:66548483-66548505 AAGTATACAAAGAAAAGGCAAGG + Intronic
1159409993 18:68060178-68060200 AGGTATACAAAGAAGCATCAGGG - Intergenic
1159678377 18:71315099-71315121 AAGTAGACACAGAAAATTCATGG + Intergenic
1159684339 18:71398995-71399017 ATGTATAAATAAAAAAATAAAGG + Intergenic
1162660043 19:12161695-12161717 CTCTATACATAGAAAAATCAAGG - Intergenic
1162970908 19:14180852-14180874 AAGGATACAGATTAAAATCAGGG - Intronic
1163016781 19:14460915-14460937 ATATATACAGAGAAATATACAGG - Intronic
1164959424 19:32414870-32414892 AAGTAAAGAGAGAAAAACCAAGG - Intronic
1165678431 19:37749194-37749216 ATATATACAGAGAAAAAGTAAGG + Intronic
1168201797 19:54820616-54820638 AGAGACACAGAGAAAAATCAGGG + Intronic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
1168703398 19:58454631-58454653 ATGAATACAAAGATAAATGATGG - Intronic
925007982 2:459924-459946 ATGGATCCAGTGAAAATTCAGGG - Intergenic
925474416 2:4197083-4197105 ATGTAGACAGATAAAGATAAAGG - Intergenic
926450380 2:12996541-12996563 ACATATTCAGAAAAAAATCAAGG + Intergenic
926613183 2:14968333-14968355 ATGTATACAAATAACAATAAGGG + Intergenic
928031776 2:27786156-27786178 AAGAATATAGAGAAAAATGAAGG + Intronic
928683218 2:33724278-33724300 ATGTTTACATTGAAAAATAAGGG - Intergenic
929368063 2:41185593-41185615 ATATATACAGATAAAAAGCCAGG - Intergenic
929683372 2:44013214-44013236 ATGTCTACACTGAAAACTCATGG - Intergenic
929961675 2:46501480-46501502 ATGTATGCAGAGGAAAAGGATGG + Intronic
930112659 2:47692146-47692168 AAGTATACTGAAAAAAATGAGGG - Intergenic
930587353 2:53283428-53283450 AGGTATACAGAGAAAAAGACAGG + Intergenic
931017825 2:58006134-58006156 CTTTATACAGAGAGAAATCTGGG + Intronic
931035650 2:58240409-58240431 ATGTAAAGAGAAAAAAATCCAGG + Intronic
931093174 2:58909389-58909411 AGGAATACATGGAAAAATCATGG - Intergenic
933108027 2:78358006-78358028 ATGTATATAAAGAAAAAAAATGG - Intergenic
933303490 2:80569240-80569262 AAGTATGCATATAAAAATCAAGG - Intronic
933982175 2:87559654-87559676 GTGTATACAGTAAAAAATTATGG - Intergenic
935317083 2:101845617-101845639 ATGTAAACATAGAAAAAGTATGG + Intronic
936140373 2:109935043-109935065 ATATATTCAGTGAAAAAGCAAGG - Intergenic
936177063 2:110232988-110233010 ATATATTCAGTGAAAAAGCAAGG - Intergenic
936204322 2:110436443-110436465 ATATATTCAGTGAAAAAGCAAGG + Intronic
936311662 2:111391156-111391178 GTGTATACAGTAAAAAATTATGG + Intergenic
936842668 2:116791625-116791647 ATGTATACAGTGAAAAGTGTTGG + Intergenic
936845104 2:116821625-116821647 ATGGATACAGTGAGAACTCAAGG + Intergenic
937179542 2:119979271-119979293 ATGTAAAGAGACAAAAGTCATGG + Exonic
938719250 2:134051307-134051329 ATGGACACAGGAAAAAATCAGGG + Intergenic
938845360 2:135203044-135203066 ATGTTTATACAGGAAAATCATGG + Intronic
939059256 2:137400309-137400331 ATGCAAACACACAAAAATCATGG - Intronic
939836749 2:147138871-147138893 ATGTTTAAAAAGAAAAATAAAGG - Intergenic
940982564 2:160019944-160019966 AAGTACACACAGAAAAAACATGG - Intronic
941257338 2:163248958-163248980 ATGTCTGCTGAGACAAATCATGG - Intergenic
941540489 2:166776975-166776997 ATGTATATAGAGAAGAGGCAGGG + Intergenic
941634459 2:167920876-167920898 ATATTTACAGAGAAAATTAAAGG + Intergenic
941706084 2:168659363-168659385 ATTTCTAGAGAGAAAAATCTAGG - Intronic
941958115 2:171225597-171225619 ATGTATAGAGTGGAAAATCTGGG - Intronic
942168353 2:173264676-173264698 ATGGAGACTGAGCAAAATCAGGG + Intronic
942717630 2:178911778-178911800 AGGCATACAGAGAAATATTATGG + Intronic
942837060 2:180313403-180313425 ATGTACACAGGTGAAAATCAAGG + Intergenic
943542610 2:189236186-189236208 AAGGATACAAAGTAAAATCAGGG - Intergenic
943556530 2:189412819-189412841 ATCAAAACATAGAAAAATCAAGG + Intergenic
943815103 2:192243971-192243993 ATCTATACAGTAAAAAATGAAGG - Intergenic
944144486 2:196492139-196492161 ATGTAAATAGAGAAAAACAAAGG + Intronic
944486818 2:200215545-200215567 ATGCACACACAAAAAAATCAAGG - Intergenic
945214209 2:207415844-207415866 ATCCATACAGTGAAAAATCAAGG + Intergenic
945308312 2:208281448-208281470 ATTTATACAGATAAAAACCAAGG - Intronic
945326147 2:208485080-208485102 ATGTATACAGAAAAGAGTGAAGG + Intronic
947511131 2:230755128-230755150 ATCTACCCAGAGGAAAATCATGG - Intronic
1169247955 20:4038688-4038710 ATGCATACAGTGAACAAACAAGG + Intergenic
1169307932 20:4509275-4509297 ATGTACATATAGAAAAATCCTGG + Intergenic
1169719378 20:8657102-8657124 AAGAAGACAGAGAAAAAACAGGG + Intronic
1171542880 20:25977990-25978012 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1173024660 20:39296674-39296696 CTGCATACAAAGAATAATCATGG + Intergenic
1173530433 20:43765475-43765497 ATCCAAACAGACAAAAATCATGG + Intergenic
1174420793 20:50397865-50397887 ATGGATACATGTAAAAATCAGGG - Intergenic
1174886814 20:54344855-54344877 AAGAATACATAGAAACATCAGGG + Intergenic
1175672397 20:60916545-60916567 TTGTATACAGTGAGAAATAAGGG + Intergenic
1176664409 21:9671618-9671640 ATGTTGACAGATAAAATTCACGG + Intergenic
1177383631 21:20379211-20379233 TTATATACAGAGAAAAAAAAGGG - Intergenic
1177441535 21:21133264-21133286 ATGTGTAGAGAGACAAGTCAAGG - Intronic
1178792919 21:35716645-35716667 TTGAATACAGAGAAAGGTCAGGG - Intronic
1178971828 21:37185704-37185726 AGGTATACCCAGAAAAATGATGG + Exonic
1182012970 22:27015901-27015923 ATGTATACATAGAAATTTTATGG - Intergenic
949409814 3:3751393-3751415 ATCTAGACAGTGAAAAATTATGG - Intronic
949698205 3:6723798-6723820 ATGTCTACAAAGAAAAATACTGG + Intergenic
949828641 3:8189807-8189829 ATGGATACAGAGTAGAATGACGG - Intergenic
950317095 3:12012309-12012331 ATGGCTACAGAGGAAAATGAAGG + Intronic
950600775 3:14033531-14033553 ATGGAAACAGAAAAAAAGCAGGG - Intronic
951366520 3:21789709-21789731 ATGTAAAAAAAGATAAATCAAGG + Intronic
951859870 3:27240252-27240274 ATGTATAATGAGAAATTTCAAGG - Intronic
951904095 3:27687113-27687135 ATGTAAACAGAAAATAATGAAGG + Intergenic
952983899 3:38760555-38760577 ATGTATAAATAAATAAATCATGG - Intronic
953206016 3:40829960-40829982 ATGAAAACAAATAAAAATCAGGG + Intergenic
953636074 3:44666062-44666084 CTCTATAAAGAGAAAAAACATGG - Intergenic
955515297 3:59720581-59720603 AGGGATACAGGCAAAAATCAAGG - Intergenic
955665316 3:61343849-61343871 ATGTGCCCAGATAAAAATCAAGG + Intergenic
956074017 3:65485454-65485476 CAGTATAAAGACAAAAATCATGG + Intronic
956205593 3:66751594-66751616 ATCTTTAGAGAGAAAAGTCATGG - Intergenic
956314411 3:67918098-67918120 ATGTATATAGAGAAACATAAAGG - Intergenic
956458596 3:69448862-69448884 ATGTATACTAAAAAAATTCAAGG - Intronic
956666646 3:71648742-71648764 GTGTATACAAATAAGAATCATGG + Intergenic
956801171 3:72759945-72759967 ATTCTTACAGAAAAAAATCAAGG + Intronic
956984384 3:74680288-74680310 ATGTAGACAGAGAAAGGTCCAGG + Intergenic
957298812 3:78364546-78364568 ATTTATACAGACAAAAATCTGGG - Intergenic
957660370 3:83143918-83143940 ATGTATGCAGAGAAATATTATGG - Intergenic
958643213 3:96835727-96835749 TTGTTTACAGAGATAAATCTGGG - Intronic
958667902 3:97163481-97163503 ATGTATAAAGACAGAAATCCTGG - Intronic
958937477 3:100272580-100272602 AAGTATAGAGAAAAAAATAAGGG + Intronic
959928349 3:111950860-111950882 ATGTATACAAGGAAGAAACAAGG + Intronic
959954447 3:112219527-112219549 ATTTAAAGAGAAAAAAATCAAGG + Intronic
960279042 3:115760579-115760601 ATGTATACAGAGAACCTTAAAGG + Intergenic
960446428 3:117754747-117754769 ATATATATATATAAAAATCAAGG - Intergenic
961536021 3:127571290-127571312 GTGTATCTAGCGAAAAATCAGGG + Intergenic
962199521 3:133389981-133390003 AAGTTCACAGAGCAAAATCACGG - Intronic
962480391 3:135793017-135793039 ATGATTACAGAGATAACTCATGG - Intergenic
962558691 3:136582955-136582977 ATGCACAAAGAGAAAAATAAAGG - Intronic
963206478 3:142641353-142641375 AAGTATATAGAAAAAAATTAAGG + Intronic
963415216 3:144986128-144986150 ATGTTCAAAGAGAAAAATCCTGG - Intergenic
963431545 3:145211942-145211964 TAGTAAACAGAGAAAAAACAAGG - Intergenic
963490748 3:145997158-145997180 ACATATAAAAAGAAAAATCAGGG - Intergenic
964076308 3:152696784-152696806 ATGTATCCAGCTAAAAATCAGGG - Intergenic
964088272 3:152844750-152844772 ATGTAGACAGAGAAGAAAAAAGG + Intergenic
964398112 3:156269031-156269053 TTGTACACAGAGAAAAATAACGG + Intronic
964525913 3:157615197-157615219 ACATAGACAGGGAAAAATCAAGG - Intronic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965154591 3:165032282-165032304 ATATATAGAGAGAAATAGCAAGG + Intronic
965173250 3:165295579-165295601 ATTTATACTAAGAAAAATAATGG - Intergenic
965216119 3:165867003-165867025 CTGAAAACAGTGAAAAATCATGG - Intergenic
965553144 3:169990858-169990880 ATTTATACAAAGCAAAATAATGG + Intronic
966069120 3:175853487-175853509 AATTAGACAGAGAAAAAGCAAGG - Intergenic
966763216 3:183435328-183435350 ATTTATACAGACAAAAATCTGGG + Intergenic
967043374 3:185714847-185714869 CTGAATACTGAGAAAAAGCAAGG - Intronic
967159214 3:186720375-186720397 TTGTATAGACAGAAAAATCATGG + Intronic
967215634 3:187207587-187207609 ATGTAAAAAGTGAAAAAGCAAGG - Intergenic
967300264 3:188005553-188005575 ATGGCTACAGAGTAAAGTCAGGG + Intergenic
967433021 3:189410624-189410646 TATTATACATAGAAAAATCATGG - Intergenic
967453052 3:189649177-189649199 ATATATACAGAGAAAATGAAAGG + Intronic
970076313 4:12225191-12225213 ATGCATACAGAAAAACATAACGG - Intergenic
970105628 4:12579717-12579739 AAGTATAGTGAAAAAAATCATGG + Intergenic
970253570 4:14142831-14142853 AGGTATACAGAAAGAAATCGAGG + Intergenic
970469525 4:16362772-16362794 ATGTATACAGTGAAAAAGTCAGG - Intergenic
970981100 4:22098366-22098388 ATGAATATAAAGAAAAATTAAGG + Intergenic
971192372 4:24439833-24439855 ATGAATGCACAGTAAAATCATGG - Intergenic
971229243 4:24785898-24785920 ATGTCTACATAGAAAAGTCTGGG - Intergenic
971919493 4:32918513-32918535 ATGAACACACAGAAAAATCAAGG - Intergenic
971988003 4:33851509-33851531 ATGAATAAATAGAAGAATCAAGG + Intergenic
972269857 4:37500936-37500958 ATGAAAACAGAAAAAAATAAGGG - Intronic
972789177 4:42354379-42354401 ATACTTACAGAGAAAAACCAGGG + Intergenic
973116725 4:46469842-46469864 TTGGATGCAGAGAAAAAACAGGG - Intronic
973136499 4:46714380-46714402 TTGTATACAGTGTAAAATGAGGG + Intergenic
973933325 4:55816215-55816237 ATGTAGTAAGAGAAAAAGCATGG + Intergenic
974155387 4:58065041-58065063 TGGAAAACAGAGAAAAATCAGGG + Intergenic
974948279 4:68554691-68554713 ATGTACACAGAGAAAAAAATTGG - Intronic
975330228 4:73104589-73104611 CTGTATAGACAGAAAAATCCTGG + Intronic
975510353 4:75188057-75188079 ATATTTACAGAGAAACAACAAGG - Intergenic
975947438 4:79724380-79724402 ATATATAAAGAGATAATTCACGG + Intergenic
976800978 4:88991717-88991739 CTGTACACAGAGAAAACTAAAGG + Intronic
976847293 4:89504234-89504256 ATGAATTCACAGAAAAGTCAGGG + Intergenic
976906675 4:90245181-90245203 ATTTTTAGAAAGAAAAATCAAGG + Intronic
976993075 4:91393942-91393964 ATGTATAGAAAGAAAAGTAATGG - Intronic
977018480 4:91727012-91727034 ATGAATAAACAGAAAAATCGAGG - Intergenic
977426518 4:96873514-96873536 AACTATTCAGAGAAAAATGAGGG - Intergenic
978093143 4:104742389-104742411 ATGTTTTTAGAGAAAAAGCAAGG - Intergenic
978781849 4:112564643-112564665 ATATATACAATGAAAAATGAAGG - Intronic
978879015 4:113677804-113677826 ATGTATACAGAGGAAAAAAATGG + Intronic
978918414 4:114152129-114152151 ATTTATACAGACAGAAATCTGGG + Intergenic
979064429 4:116110685-116110707 TTGTATATAGTGAAAAATTAAGG - Intergenic
979120938 4:116900105-116900127 ATATATACAGAGAGAGAGCAAGG - Intergenic
979403435 4:120280097-120280119 ATGTATATAAAGAAAAAGTATGG + Intergenic
979515213 4:121600577-121600599 TTGTCTACATAGAAAATTCATGG + Intergenic
980234399 4:130086442-130086464 CTTTGTACAGAGAAAAATTATGG + Intergenic
980538235 4:134158992-134159014 ATTGATACATAGAAAAAGCACGG + Intergenic
980652586 4:135738305-135738327 CTGTGTACAGATAAAAATAAAGG - Intergenic
980882025 4:138720667-138720689 AAGGATTCAGAGAAAAAACAAGG - Intergenic
981032739 4:140141889-140141911 ATGTATAAAGAGAAAAAAGTTGG - Intronic
981504580 4:145484845-145484867 ATCAATACAGTGAAAATTCAGGG - Intronic
981594571 4:146404816-146404838 ATTTTTACAGTGAAATATCAGGG - Intronic
981942532 4:150298516-150298538 TTTTAGACAGAGAAAAAGCAGGG + Intronic
982649280 4:158066299-158066321 AGCAATACAGAGAAAAAACAGGG - Intergenic
982661380 4:158210661-158210683 ATGGTTAAAAAGAAAAATCAAGG + Intronic
982921937 4:161286765-161286787 ATTAAAAGAGAGAAAAATCAAGG - Intergenic
983002700 4:162438078-162438100 ATGTATAAAAATAAAAATAAAGG - Intergenic
983214566 4:164991242-164991264 AAGTATAGAGAGAGAAATAAGGG - Intergenic
984135508 4:175932651-175932673 ATGTATAGAAAGAAAATACATGG + Intronic
984214059 4:176886333-176886355 ATGTAAAAAGAGAAAAGCCAGGG - Intergenic
984219949 4:176962386-176962408 AGCTATACAGATAAAAATAAAGG + Intergenic
984243652 4:177248359-177248381 ATGTATACAGAGAAGAGTGAGGG + Intronic
984260387 4:177437770-177437792 ATATATAAAGAGAGAAATTAGGG - Intronic
984395230 4:179189263-179189285 AAGTATACAGTGAATAATGAAGG + Intergenic
984402665 4:179287058-179287080 ATAAATAAAGAGAAAAATAAAGG + Intergenic
984441758 4:179779748-179779770 ATGTATACAGGGCAAAATCTAGG - Intergenic
985360303 4:189169048-189169070 ATTGATACAGAGAAAAGACACGG + Intergenic
985916632 5:2924651-2924673 ATTTTTACATAGTAAAATCAAGG - Intergenic
986471231 5:8078113-8078135 ATGGATACAGGGAAAGATGAAGG + Intergenic
986569101 5:9147016-9147038 ATGTGTACAGAGAAATTGCAGGG - Intronic
986573101 5:9185403-9185425 AATTTTACATAGAAAAATCAGGG - Intronic
986764268 5:10909878-10909900 ATGTATACACACAAAATTCAGGG + Intergenic
986904612 5:12480063-12480085 ATGAAAACTGAAAAAAATCAAGG + Intergenic
986930550 5:12814849-12814871 ATGACTACAGAGAATAAGCAAGG - Intergenic
987205079 5:15617052-15617074 ATGCAGATAGAGAGAAATCATGG - Intronic
987553721 5:19417605-19417627 ATGTATAAAGAGATCACTCATGG - Intergenic
987620153 5:20329802-20329824 ATGTACACAGACTAAAATTAAGG - Intronic
987770869 5:22302704-22302726 ATGTATCTAGAGAAAAAAGAAGG + Intronic
987855231 5:23412198-23412220 ATGTATACAGAGAAAGAGGGAGG + Intergenic
987908350 5:24108354-24108376 GTATACACACAGAAAAATCAGGG - Intronic
988122279 5:26981463-26981485 AAATATTCAGAGAAAAATAAAGG - Intronic
988804019 5:34723253-34723275 ATCTATAGAGAGAAAAAAAAAGG + Intronic
989441452 5:41476651-41476673 AAGAATACAAAGAAAAATCAGGG - Intronic
991038646 5:62153675-62153697 ATGTTTACAAAGATAAATCCAGG - Intergenic
991430572 5:66540636-66540658 TTAAATACAGAGAAAAATCCAGG - Intergenic
991982536 5:72248041-72248063 ATGTAAAGACAGAAAAATTAAGG + Intronic
992816923 5:80451117-80451139 ATAGATACACTGAAAAATCAAGG - Intronic
993150059 5:84149916-84149938 AAATATACAGAAAAAAATCTGGG + Intronic
993648474 5:90488671-90488693 ATGTATAATGATAACAATCACGG - Intronic
994003387 5:94807911-94807933 GTGTATACAGAAAAAAAGCTAGG + Intronic
994477885 5:100293166-100293188 AGCTATGCAGAGAAAAATTAAGG - Intergenic
994587867 5:101734006-101734028 CAGTAGCCAGAGAAAAATCAGGG - Intergenic
994681581 5:102894431-102894453 AGGAGTTCAGAGAAAAATCAGGG - Intronic
995345433 5:111110465-111110487 ATGTTGAAAGAGAAAAGTCATGG + Intronic
995419581 5:111948959-111948981 ATGTACAAAGAGAAAACACAAGG + Intronic
996222122 5:120947118-120947140 ATGCATTCAGAGAAAAACCTCGG - Intergenic
996565461 5:124875486-124875508 ATGTACAAAGAGAGAAATGAAGG + Intergenic
996972815 5:129393661-129393683 ATGTTTTCAGACAAAAATTATGG + Intergenic
998725537 5:145009070-145009092 ATGCAATCAGAGAAAAATCCAGG - Intergenic
999903927 5:156118464-156118486 ATGCACACAGAGAAGAGTCAGGG + Intronic
1000297365 5:159923593-159923615 ATGTATTCAGAGGAAAATCTTGG - Intronic
1000621903 5:163495413-163495435 ATTTATACAGACAAAAATCTGGG - Intergenic
1000868470 5:166544789-166544811 ATGAATCCAAAGAAAAATAAAGG - Intergenic
1002047684 5:176550976-176550998 AAGGACACAGAGAAGAATCAGGG - Intronic
1002717669 5:181238377-181238399 AGGTATACAGAGATAAATATTGG - Intronic
1003231917 6:4261978-4262000 ATATTTCCAAAGAAAAATCATGG - Intergenic
1003250168 6:4421110-4421132 ATGTAAACAGAAAAAAATAAGGG + Intergenic
1004298265 6:14433970-14433992 ATTTATACAGATAGAAATCTGGG + Intergenic
1004348992 6:14874627-14874649 ATAATTTCAGAGAAAAATCAAGG - Intergenic
1004726337 6:18314651-18314673 CTTTTTAAAGAGAAAAATCAAGG - Intergenic
1005295427 6:24421102-24421124 ATGTATTTAGAGAAAAGACAGGG - Intronic
1005360449 6:25026759-25026781 AGGTAAACAGAGGAAAATCTTGG + Intronic
1005937469 6:30534487-30534509 ATATATAGAGAGAGAAATAAAGG - Intergenic
1006759944 6:36451409-36451431 ATGTATCCACAGAAAAAAGATGG - Intronic
1007023054 6:38541994-38542016 ATTTATACAGAGAATATACAGGG + Intronic
1007067253 6:39003335-39003357 AAGTTAACAGAGATAAATCAGGG - Intronic
1007440658 6:41856900-41856922 ATGTATATACAGGAAAAACATGG + Intronic
1007825606 6:44598605-44598627 ATGTGAACAGCTAAAAATCATGG - Intergenic
1009264665 6:61537903-61537925 ATATAGAGAGAGAAAACTCATGG + Intergenic
1009768204 6:68109448-68109470 GTGTATACAGGAAAAAAACATGG + Intergenic
1010436042 6:75832200-75832222 ATGTAAACAGAGGCAAATCTAGG + Intronic
1010497711 6:76555500-76555522 ATGGATAAAGAGAAAATTCTTGG + Intergenic
1010539380 6:77071914-77071936 ATGTATATATAGAAAAAGCAAGG - Intergenic
1011633334 6:89348371-89348393 TTGTATACAGCTAAAAATAAAGG + Intronic
1011959531 6:93069962-93069984 TTGTATACAGAGAAATGTCCTGG + Intergenic
1012269597 6:97192305-97192327 ATAATTACAGAGAAAAATAAGGG + Intronic
1012579878 6:100853980-100854002 ATATATAGAGGGAAAAATTATGG - Intronic
1012601888 6:101109091-101109113 ATATAGACAGAGAAAAATATAGG - Intergenic
1013555718 6:111255183-111255205 ATGTATAGAGAAAGAAATAAGGG + Intergenic
1013651942 6:112203927-112203949 ACTTACACAGAGAAAAAACATGG + Intronic
1014196488 6:118566009-118566031 CTGTATGCAGAGAAGAGTCAAGG - Exonic
1014528476 6:122530473-122530495 AGGCATACAAAGAAAAAACATGG - Intronic
1015316465 6:131822551-131822573 ATGTACACATAGAAAAGTCCTGG - Intronic
1015356091 6:132278443-132278465 ATGTGTAATGATAAAAATCAGGG + Intergenic
1015402167 6:132798878-132798900 ATGTAGACACAGAAAAGGCAGGG + Intergenic
1015509892 6:134027995-134028017 ATGTAGAAGGAAAAAAATCAAGG - Intronic
1015703962 6:136067157-136067179 ATTCCTACAGAGAAAAAACATGG - Intronic
1015789326 6:136950723-136950745 ATATATACAGAGAACAAAAATGG - Intergenic
1016116805 6:140296648-140296670 CTGTATACATATAAATATCAAGG - Intergenic
1017338950 6:153297733-153297755 ATGTGTACAGAGAAAAGGCTGGG - Intergenic
1017364469 6:153618403-153618425 ATATATATATATAAAAATCAGGG + Intergenic
1017489094 6:154928623-154928645 ATGAGTACAGAGGAAATTCATGG + Intronic
1020490598 7:8779252-8779274 AGGCATATAGAGAAAAATAAAGG - Intergenic
1020512245 7:9072329-9072351 ATGATTACAAAGAATAATCATGG + Intergenic
1021167153 7:17355309-17355331 ATGTAACCAGTGAAAAGTCAGGG - Intergenic
1021169173 7:17377287-17377309 ATGTATACAGAAAATTATCTGGG + Intergenic
1021261838 7:18468011-18468033 AGGTGTTCAGAGAAAGATCATGG + Intronic
1021785856 7:24151966-24151988 AGGAATGCAGAGAAAAATCAAGG - Intergenic
1022031398 7:26494365-26494387 ATGTAGAGAAAGAAAAAACAGGG - Intergenic
1022140591 7:27489970-27489992 ATGCACACATAGAAAAGTCATGG - Intergenic
1022614411 7:31914429-31914451 ATTAACAAAGAGAAAAATCAAGG - Intronic
1022643572 7:32210296-32210318 ATGTATACATACAACAACCAAGG - Intronic
1022732900 7:33047670-33047692 TTATATACATAGAAAAATAAAGG + Intronic
1022997808 7:35775801-35775823 ATTTATGGAGAGAAAAAACAGGG + Intergenic
1023322857 7:39018253-39018275 TTGTATACAAAGGAAAATAATGG - Intronic
1023704066 7:42921203-42921225 CTGTATACAGTGTCAAATCAGGG - Intronic
1023707778 7:42960194-42960216 GTGTTTACAGAGAGAAAGCAGGG + Intergenic
1024019472 7:45352557-45352579 ATCTAAACAGAGAAAAAGTATGG + Intergenic
1024138327 7:46433449-46433471 ATGTATAAATGTAAAAATCATGG + Intergenic
1024186879 7:46958472-46958494 CTGTATACTCAGAAAGATCAGGG + Intergenic
1024367677 7:48540119-48540141 ATGACTGCAGAGAAAAATCAAGG - Intronic
1024461916 7:49668129-49668151 ATGTCTTCACAGAAAAATCTGGG - Intergenic
1024783167 7:52875464-52875486 ATCTATGCAGATAGAAATCAAGG - Intergenic
1025138977 7:56447279-56447301 AGGTAAACAAATAAAAATCAGGG + Intergenic
1025149028 7:56532369-56532391 ATATACACAAAGAAAAATAAAGG + Intergenic
1025706445 7:63869432-63869454 ATGTATAAAGTGAACAATTAGGG - Intergenic
1025811223 7:64876894-64876916 ATGAAAGCAAAGAAAAATCAAGG - Intronic
1026235053 7:68520234-68520256 ATGAATTCAGAGGAAAAGCAAGG - Intergenic
1027886354 7:83911108-83911130 ATTCTTACAAAGAAAAATCAAGG - Intergenic
1027957319 7:84897355-84897377 ATGTACACAGAGAAATAAAAAGG + Intergenic
1028078147 7:86540169-86540191 AGGGATACAGAGAAACATAAAGG + Intergenic
1028194466 7:87889578-87889600 ATGTATTCAGTAAAAAATGAGGG - Intronic
1028597457 7:92560586-92560608 TTGAATACACAGAAAATTCAAGG - Intergenic
1028713522 7:93938064-93938086 ATTTAAACAGAGTAAAAACAGGG - Intergenic
1030960798 7:115919053-115919075 CTTTATGCAGTGAAAAATCAAGG + Intergenic
1031075618 7:117209349-117209371 ATGTGTATAGAAAAAAATAATGG + Intronic
1031150789 7:118051770-118051792 ATGTATCCTGACAAAAATTAGGG + Intergenic
1031381830 7:121095564-121095586 ATGTATACATATAAAAATAAAGG + Intronic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1031871808 7:127095874-127095896 GAGGATACAGAGACAAATCATGG - Intronic
1033145530 7:138867705-138867727 ACGTATAGAGAGGAAAAACACGG + Intronic
1033627646 7:143126518-143126540 ATTTATACAGATAAAGTTCAGGG - Intergenic
1034389785 7:150776707-150776729 ATGTTTTCAAAGAAAAATCAGGG + Intergenic
1034600445 7:152248385-152248407 TGGTATCCAGAGAAGAATCAAGG - Exonic
1034607492 7:152330523-152330545 ATGACTATAGAGAAAATTCAAGG - Intronic
1034888861 7:154821708-154821730 ATATATATACAGAAAAAACATGG + Intronic
1036035221 8:5011478-5011500 ATGTAAACTGAGAAAATTAATGG + Intergenic
1037020407 8:13962911-13962933 TTCTAGACAGAAAAAAATCATGG + Intergenic
1037049509 8:14352898-14352920 ATGTATGCAGAGATCAATTAGGG - Intronic
1037260050 8:16998843-16998865 ATAAATACAGAGATAACTCATGG + Intronic
1037316543 8:17604811-17604833 ATGTATACAAAGAAAATGCATGG + Intronic
1037799919 8:22027129-22027151 ATGTATACAGGTAAAAAAAAGGG - Intronic
1038050077 8:23800591-23800613 ATGTAAAAAGTTAAAAATCAAGG + Intergenic
1038080038 8:24124083-24124105 AGGTATACAGTGATAAATTAGGG - Intergenic
1038156319 8:24994074-24994096 ATGTAAACATATAAAAATCCTGG - Intergenic
1040126091 8:43739625-43739647 AAGTATACAGAAAGAAATAAGGG + Intergenic
1041610103 8:59836156-59836178 ATCTATTCAGAGTAATATCAGGG + Intergenic
1042257937 8:66825685-66825707 ATTTACACAGAGAAAAATAGAGG + Intronic
1042329463 8:67562960-67562982 ACGTATACAGAGAAAACAGAGGG - Intronic
1042361509 8:67888666-67888688 ATGTAAAAGGAGAAAAAACATGG - Intergenic
1043472265 8:80574787-80574809 AGGTATAAAAAGAAAAAACAAGG + Intergenic
1043931888 8:86100885-86100907 AAGAATTCAGAGATAAATCAAGG + Intronic
1044100930 8:88137643-88137665 ATGTATAAAGAGAAAATTGCAGG - Intronic
1044198650 8:89408735-89408757 ATGGAAACAGAAAAAAATAAAGG - Intergenic
1044371056 8:91411554-91411576 AAATATAGAGAGAAAAATCTTGG + Intergenic
1044434822 8:92149845-92149867 TTGTGTATAGAGAAAAAACAAGG + Intergenic
1044893475 8:96862713-96862735 ATGTTTCCAGCTAAAAATCAGGG - Intronic
1045826453 8:106403817-106403839 ATGTACACAGACAAAAATCCAGG - Intronic
1046541411 8:115588330-115588352 ATTTGTTTAGAGAAAAATCATGG - Intronic
1046726054 8:117675140-117675162 ATGTATATAGAGAAACTTGATGG + Intergenic
1046885876 8:119366450-119366472 AGGTTCAAAGAGAAAAATCATGG + Intergenic
1047280962 8:123445215-123445237 ATGTTTACATAGAAAATTCCTGG - Intronic
1047429506 8:124778918-124778940 GTGTGTACAGAGAAAAGCCATGG - Intergenic
1047987855 8:130254668-130254690 ATGTAAACAGTGCTAAATCAAGG + Intronic
1048143184 8:131815648-131815670 AGGTAAACAGAGAAATATAATGG + Intergenic
1048406344 8:134126522-134126544 ATGTACGTAGAGGAAAATCACGG + Intergenic
1048632892 8:136263373-136263395 ATATGTATATAGAAAAATCATGG - Intergenic
1049489416 8:142886841-142886863 ATTTATAAAGAGTACAATCATGG + Intronic
1049743816 8:144254583-144254605 AAGGACACAGAGAAAAATCTGGG - Intronic
1050136567 9:2472047-2472069 ATGAAGAAAGAGAATAATCAGGG - Intergenic
1050651437 9:7781198-7781220 ATATATACAGGGAAAAAAGAAGG - Intergenic
1050810846 9:9745546-9745568 ATGTAAATGGATAAAAATCATGG - Intronic
1051043730 9:12848272-12848294 GAGTATACAAAGAAAAATAAAGG + Intergenic
1051162527 9:14224381-14224403 AAGTGTCCTGAGAAAAATCAAGG + Intronic
1051459786 9:17298802-17298824 AAATAAACAGAGAAAAATCCTGG - Intronic
1051566064 9:18499512-18499534 ATCTATACACAGAAACATCCTGG - Intronic
1052000601 9:23274858-23274880 ATGGATATAGAGCTAAATCAGGG + Intergenic
1052100135 9:24436048-24436070 ATTTATGCAGAAAAAAAACAAGG + Intergenic
1052101256 9:24448577-24448599 ATTTATACAGAAAGAAATCCAGG - Intergenic
1052655754 9:31358052-31358074 ATGTATAGAGAGAAACAATATGG + Intergenic
1053866598 9:42444363-42444385 ATGTAAACAGAAAAAAATAATGG - Intergenic
1054355262 9:64055092-64055114 GTGTGTAGAAAGAAAAATCAAGG - Intergenic
1054708054 9:68483063-68483085 AAGGAAAGAGAGAAAAATCAAGG - Intronic
1055782643 9:79835987-79836009 ATGTATTTATAGAAAGATCAAGG + Intergenic
1056647215 9:88424112-88424134 ATGTATACAGAGAAAAAGTATGG + Intronic
1056890497 9:90487706-90487728 AGGTATGCAAAGAAAAATAAAGG + Intergenic
1056991795 9:91420325-91420347 ATTTACAAAGAGAAAAATGAAGG + Intronic
1057940197 9:99275194-99275216 AAGTATAGAGACAAAAAACAAGG + Intergenic
1058549054 9:106093705-106093727 ATGTAGACAGGGAAGAAACAAGG + Intergenic
1058747532 9:108006766-108006788 CTGTAAACACAGAGAAATCAAGG - Intergenic
1058803052 9:108563473-108563495 ATTTATAAGGAGAAAAATCTAGG - Intergenic
1058993449 9:110276399-110276421 ATGAACACAGAGAGAAAACAAGG + Intergenic
1059592505 9:115677383-115677405 ATTTATACAGACAAAAATCCAGG + Intergenic
1059662843 9:116418888-116418910 ATGTTTACAGAGCAAACTCCTGG - Intergenic
1059951571 9:119468566-119468588 ATGTATAAAGAGCAAAATATGGG - Intergenic
1060579937 9:124736435-124736457 AAGTCTGCAAAGAAAAATCAGGG - Intronic
1062020528 9:134317292-134317314 ATGTATACACAGAAATCTGAAGG - Intronic
1203559652 Un_KI270744v1:41055-41077 TTTTATCCAGAGACAAATCACGG - Intergenic
1203661692 Un_KI270753v1:50134-50156 ATGTTGACAGATAAAATTCACGG - Intergenic
1185993380 X:4916206-4916228 TTGTAGAAAGAGCAAAATCATGG + Intergenic
1186262581 X:7795470-7795492 ATGTATACAGGTAAGAATCTAGG + Intergenic
1186306856 X:8270675-8270697 ATGTATAGAGAGAAACTTAATGG + Intergenic
1187060101 X:15778495-15778517 ATGGATAAAGAGATCAATCAAGG + Intronic
1187597401 X:20788243-20788265 ATTTAGACAGAGAAGAATCAAGG - Intergenic
1188167844 X:26884646-26884668 AGGTACACAGAGAAAAAGCCTGG + Intergenic
1188174713 X:26975215-26975237 ATCTATACAGTTAAAAGTCAGGG - Intergenic
1188618121 X:32184414-32184436 ATCTATACAGACAAAAATTAGGG - Intronic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1188960895 X:36490218-36490240 ATGGTTACAAAGAAAAGTCAGGG + Intergenic
1189196066 X:39153987-39154009 ATTTTTACAGGGACAAATCAGGG - Intergenic
1189519431 X:41750557-41750579 CTGTATGCAGAGAGAAATTAAGG + Intronic
1189523445 X:41795295-41795317 AGCTATTCAGGGAAAAATCAAGG - Intronic
1189658371 X:43270831-43270853 ATGTGTGCAGCTAAAAATCAGGG + Intergenic
1190578510 X:51867315-51867337 ATATATACACATAAAAATAAAGG + Intronic
1190781649 X:53602294-53602316 ATGTATTCAGAGAAAAAAGACGG + Intronic
1191081839 X:56520478-56520500 ATGTAGAGAGAGAGAAATAAAGG - Intergenic
1192219744 X:69189651-69189673 ATGCACACAGAGAGAAATGAAGG - Intergenic
1192896291 X:75446099-75446121 ATTTATACAGATAGAAATCTAGG + Intronic
1192924589 X:75742137-75742159 ATGTATACCCAGAAAAATGATGG - Intergenic
1192946764 X:75971528-75971550 ATGTAAAGAGAGAAAAATATAGG + Intergenic
1193024020 X:76824559-76824581 ATATATACATAAAAAATTCAGGG - Intergenic
1193132660 X:77933879-77933901 ATTAATACAGTGAAAAAACAAGG + Intronic
1193430649 X:81399888-81399910 ATATATAGAAAGAAAAATCCGGG - Intergenic
1193543348 X:82797621-82797643 ATGAATACAGTGAAAGTTCAGGG + Intergenic
1195073638 X:101305151-101305173 TTGTATACATAGAAAACCCAAGG - Intergenic
1195150970 X:102069691-102069713 ATGCATGCAGAGAAAAATAATGG - Intergenic
1195438257 X:104870714-104870736 AGGTATCCTGAGAAAAATCACGG - Intronic
1196140502 X:112256905-112256927 TTGTCTACAGAGAATACTCAAGG - Intergenic
1196211140 X:112997052-112997074 ATGTATTCACAGGAAAATGATGG + Intergenic
1196242378 X:113357390-113357412 ATGTGTTCAGACAAAAAGCAAGG + Intergenic
1196371784 X:114987299-114987321 ATGTAAATAGATAAAGATCAAGG - Intergenic
1197481110 X:126987081-126987103 ATGTACACAGAGAAAAAGTCTGG - Intergenic
1199087833 X:143649452-143649474 GTGTACACACACAAAAATCAAGG + Intergenic
1199371673 X:147056924-147056946 ATGTATCCAACAAAAAATCAGGG - Intergenic
1199453688 X:148002803-148002825 ATATATATTGACAAAAATCAAGG - Intronic
1199530921 X:148846778-148846800 ATGTTTACACAGTAATATCATGG + Intronic
1199807355 X:151313459-151313481 ATGAAAACAAAGAAAAATAATGG + Intergenic
1200699910 Y:6393246-6393268 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200910708 Y:8529162-8529184 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200913096 Y:8548268-8548290 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200913416 Y:8550754-8550776 ATGAAAACAAAGAAAAATGAAGG - Intergenic
1200917022 Y:8580274-8580296 ATGAAAGCAAAGAAAAATCATGG - Intergenic
1200926290 Y:8657887-8657909 ATGAAAACAAAGAAAAGTCAAGG - Intergenic
1200933714 Y:8720158-8720180 AGGAAAACAAAGAAAAATCAAGG + Intergenic
1200934625 Y:8727455-8727477 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200935326 Y:8733333-8733355 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200938805 Y:8761498-8761520 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1200961863 Y:9003282-9003304 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1200982028 Y:9271224-9271246 ATGAAAGCAAAGAAAAATCAAGG + Intergenic
1201034201 Y:9771452-9771474 ATGAAAGCAAAGAAAAATCAAGG - Intergenic
1201587122 Y:15573344-15573366 ATGCAGACACAGAGAAATCACGG + Intergenic
1202149216 Y:21829587-21829609 ATGAAAGCAAAGAAAAATCAAGG - Intergenic