ID: 1088064432

View in Genome Browser
Species Human (GRCh38)
Location 11:105698794-105698816
Sequence TGTGGCTGAAAGACCTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088064432 Original CRISPR TGTGGCTGAAAGACCTATTT AGG Intronic
903680468 1:25093069-25093091 GGTGGCTGACAGACCTATACTGG + Intergenic
905607584 1:39316921-39316943 TCTGGCTAAATGACTTATTTTGG + Intronic
907841902 1:58166607-58166629 TGTCCCTGAAAGACTTGTTTGGG - Intronic
910441322 1:87255283-87255305 TTTGGCTGTAAGACCTGTTGTGG + Intergenic
912544959 1:110444051-110444073 GGTGGCTGTGAGGCCTATTTGGG + Intergenic
915194458 1:154179050-154179072 TGTGGCAGAAAGCCAGATTTAGG - Intronic
915682434 1:157594742-157594764 TGTAACTAAAAGATCTATTTGGG - Intronic
919058011 1:192595036-192595058 TCTGGATGAAAGTCTTATTTTGG + Intergenic
920592969 1:207239989-207240011 AGTGGCTGAACCACTTATTTGGG + Intergenic
920773315 1:208910775-208910797 TGTGGCTATAAGACCTCTTCTGG + Intergenic
924018352 1:239753017-239753039 TTTGTTTGAAAGAACTATTTGGG + Intronic
1062793777 10:326878-326900 TGTGACTGAAAGATCTCTTCTGG + Intronic
1063911622 10:10835990-10836012 GGAGGTTGAAAGACCAATTTTGG + Intergenic
1065032004 10:21596419-21596441 TGTGGTTGAAGGGCCTAGTTTGG + Intronic
1069340591 10:67403770-67403792 TGTGGCTGGAAACCCTGTTTTGG - Intronic
1070519416 10:77238868-77238890 TGTGGGTCAAACACCCATTTGGG - Intronic
1071477814 10:86039775-86039797 GGTGGATTAAAGACCTGTTTTGG - Intronic
1077415219 11:2421576-2421598 TCTGGCTGGAAGATCTCTTTGGG + Intronic
1080022312 11:27575558-27575580 TGTGGCTGAAAAAGCTATTGAGG - Intergenic
1083973819 11:66100821-66100843 TGTGGCTGGAACACCTGTTATGG + Intronic
1085213894 11:74810393-74810415 TGGACCTGAAAGACCTATGTTGG + Intronic
1088064432 11:105698794-105698816 TGTGGCTGAAAGACCTATTTAGG + Intronic
1091259063 11:134219389-134219411 TGTGGCTGCTAGACCTACTTTGG + Intronic
1091628185 12:2138658-2138680 TGTGGCTGAAAGACCATGTTGGG - Intronic
1092506352 12:9104827-9104849 TGTGCCCCAAACACCTATTTTGG + Intronic
1094135730 12:27123636-27123658 TGTGCCTGAATGACCTACTGTGG + Intergenic
1094185266 12:27635366-27635388 TGTGCCTGAATGACCTACTGTGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1095213179 12:39517834-39517856 TGTGCCTTGAAGACCTTTTTGGG - Intergenic
1099539837 12:83894141-83894163 TGTGGCTATATGACCTACTTTGG - Intergenic
1099939072 12:89163467-89163489 TGTGATTGAAAGTCCTTTTTAGG - Intergenic
1102808797 12:115805723-115805745 TGTGCATGAAAGATCTGTTTTGG - Intergenic
1103213787 12:119186344-119186366 TGTGGCTTAAAGAGCTAATCGGG + Intronic
1103432676 12:120902634-120902656 TGGAGTTGGAAGACCTATTTCGG - Intronic
1106545162 13:30724821-30724843 TGTGTCTGCAGGACCTACTTGGG - Intronic
1107119717 13:36782956-36782978 TCTGCCTGAAAGACCACTTTAGG - Intergenic
1108967589 13:56329074-56329096 TGTTGTTGAAATACCTATTATGG + Intergenic
1116566893 14:46458352-46458374 TGTGGCTGATCCATCTATTTTGG - Intergenic
1120794222 14:88614342-88614364 TGTGGCTGAAGGACTGATTATGG - Exonic
1125917277 15:43500079-43500101 TGTGGGTCAAAGACGTAGTTAGG - Intronic
1129070721 15:72948195-72948217 TGTGCCTGGAAGACCTTTTTGGG - Intergenic
1130971617 15:88738298-88738320 TATGGCTCACAGACCTCTTTGGG + Intergenic
1135076681 16:19400100-19400122 TGTGGCTCAAAAGGCTATTTTGG - Intergenic
1138058794 16:53865354-53865376 TGTGGCTGTAAGGCCTAATGAGG - Intronic
1147060455 17:37872833-37872855 TGTGGTTGAAGGGCCTAGTTTGG - Intergenic
1147656968 17:42096588-42096610 AGTGACTGAAAGTCCTGTTTGGG - Intergenic
1148087113 17:45000995-45001017 TGGGCCTGATAGAACTATTTTGG - Intergenic
1148409741 17:47455317-47455339 TGTGGTTGAAGGGCCTAGTTTGG - Intergenic
1150476144 17:65476921-65476943 TGTGGCTGACAGTCGTCTTTGGG - Intergenic
1151991165 17:77575296-77575318 TGATGTTGAAAGACATATTTGGG - Intergenic
1153526609 18:6000920-6000942 TCTGACTGATAGAACTATTTTGG + Intronic
1154220363 18:12447723-12447745 TGTGAATGAAAGTCTTATTTTGG + Exonic
1155289058 18:24322426-24322448 TGTGGCTTTAAGATTTATTTTGG + Intronic
1155960407 18:31990097-31990119 TTTGGCTGAAAGAACAGTTTCGG + Intergenic
1157809355 18:50683735-50683757 TGGGGCTGAAAGAGCTGTGTGGG - Intronic
1158759989 18:60373297-60373319 TATGGCTGGAAGAACTATGTAGG + Intergenic
1159371936 18:67539299-67539321 TGTGGGGGAAACATCTATTTTGG + Intergenic
1159856499 18:73596030-73596052 TGTAGTTGAAAGGCCTCTTTTGG + Intergenic
1160342089 18:78097976-78097998 TGTGGCTTCAAGACCTCCTTGGG - Intergenic
1162311613 19:9911236-9911258 GGAGTCTGAAAGACCTATGTTGG - Intronic
1163583321 19:18151044-18151066 TGTGTCTGAAACACCTGTTAGGG + Exonic
1163650888 19:18517021-18517043 TGTTGCTGAGTGACCTCTTTTGG - Intronic
1164421198 19:28094467-28094489 TGTGGCTGGGAGACCTACCTAGG + Intergenic
1165021545 19:32928482-32928504 TATGGCTAAAAGAGCTTTTTAGG - Intronic
1165820843 19:38674976-38674998 TGTGGCTGAATGACGTATCTGGG + Intronic
926070175 2:9881876-9881898 TGTTGCTGAAAGAACCATTAAGG - Intronic
927285578 2:21353529-21353551 TGTAGCTGAATGACCCATTCTGG + Intergenic
931325519 2:61218130-61218152 GCTGGCTGAAAAACCTTTTTGGG + Intronic
933689091 2:85165613-85165635 TGGGGTTGGAAGACCTGTTTGGG + Intronic
941944768 2:171083200-171083222 TTTGGCTGAAAGTATTATTTGGG + Intronic
944270413 2:197778552-197778574 TGTGCCTCAGAGACCTAATTAGG - Intronic
944788520 2:203099620-203099642 TGTCCCTGAAACACCTATTGAGG - Exonic
946177382 2:217929803-217929825 TGTGGCTCAGAGAGGTATTTAGG - Intronic
1169600049 20:7248096-7248118 TGTGTCTGAAAGACTTTTCTAGG + Intergenic
1169710787 20:8560834-8560856 TGTGGCTTAAAGAAATTTTTTGG - Intronic
1173340285 20:42147185-42147207 TGTGCTTGAAAGACCTATTTAGG + Intronic
1174671445 20:52311492-52311514 TATGGATGAAACACCTTTTTGGG - Intergenic
1179308983 21:40180320-40180342 TGTGGCTTAAAGACTGCTTTTGG + Intronic
1180241460 21:46509748-46509770 TGTGAATGAAATACGTATTTAGG + Intronic
1182648856 22:31834165-31834187 TGTGACTGAATGACCTGTTTTGG + Intronic
1184554350 22:45225179-45225201 AGTGGATGAAAGGCCTATTGAGG - Intronic
1185206731 22:49543444-49543466 TGAGGATGAAAGACCCATTGAGG - Intronic
952791798 3:37206266-37206288 TGTGGGTGAATGACCAAGTTAGG - Intergenic
953014150 3:39056702-39056724 TGTGGAGGAAAGACCTTTTCAGG + Intronic
959495417 3:107045100-107045122 TGTTGATGAAATACCTAATTAGG - Intergenic
960192586 3:114724617-114724639 TGTATCTCAAAGAGCTATTTAGG + Intronic
960708737 3:120506380-120506402 TATGGCTGAAGGACTTATTCTGG - Intergenic
961433209 3:126897919-126897941 TGAGGCTGAAAGACTCATCTAGG - Intronic
962008659 3:131372299-131372321 TGTGGGTGAGAGTCCTGTTTGGG - Intergenic
964440117 3:156699931-156699953 TGGGGCTGAAGGACCTAGTAGGG + Intronic
965770877 3:172179947-172179969 TGTGGCTGAATGACCTCTTTGGG + Intronic
965942938 3:174207342-174207364 TGTGGCTGAAGAACCTGTTAGGG - Intronic
966293676 3:178391285-178391307 TGAAGCTGTAAGACCTTTTTAGG + Intergenic
969943209 4:10755919-10755941 TGTGGCTGGAAGACCAATGAAGG - Intergenic
972118269 4:35666425-35666447 TGTGTCTGAAAAACCTTATTAGG - Intergenic
972436860 4:39043757-39043779 GGTGGCTGGGAGATCTATTTAGG - Intergenic
974308274 4:60171270-60171292 TTTGGATAAAAGAACTATTTGGG + Intergenic
976979805 4:91213379-91213401 TGAAGCTGGGAGACCTATTTTGG - Intronic
979051408 4:115938582-115938604 TGTGACTAAAAGGACTATTTAGG + Intergenic
979998020 4:127456129-127456151 TATGGCTGAAGAAACTATTTGGG + Intergenic
981746408 4:148056404-148056426 AGTGACTGAAAAACCTATGTGGG + Intronic
984954983 4:185036266-185036288 TGTGACTGAAAGTAATATTTGGG - Intergenic
985399324 4:189578722-189578744 TTTGGCTGAAAGGCCGGTTTTGG + Intergenic
986309646 5:6542795-6542817 TGTGGCTGAAGGAGCTCTGTGGG - Intergenic
986483447 5:8212258-8212280 TGAAGCTTAAGGACCTATTTGGG + Intergenic
992307499 5:75458018-75458040 TGTAGTTGAAACACCTGTTTTGG - Intronic
992730539 5:79663185-79663207 TTTGGCTTAAAGAAGTATTTTGG + Intronic
993686545 5:90944802-90944824 TGTTGCTGAAACTCCTCTTTGGG + Intronic
994122547 5:96133239-96133261 TCTGGCTTAAAGACCACTTTTGG + Intergenic
994235253 5:97355663-97355685 GGTGGCTGGAGGACCTGTTTGGG + Intergenic
997039643 5:130236364-130236386 AGAAGCTGAAACACCTATTTAGG + Intergenic
998007866 5:138669130-138669152 TGTAGCAGAATGACCTATTGAGG + Intronic
999018739 5:148139328-148139350 TGGGGCTGACAGAAGTATTTTGG - Intergenic
1000311518 5:160049724-160049746 TGTGTCTGAAAGGATTATTTAGG - Intronic
1000393769 5:160751321-160751343 TGAGTCTGAAACACCTTTTTAGG - Intronic
1003099455 6:3165871-3165893 TCTGGCTGAAAGGCCTCGTTGGG + Intergenic
1003566163 6:7224432-7224454 CTTGGCTGAAAGATCTATATTGG - Intronic
1007516089 6:42412559-42412581 GGTGGCTGACAGACTTCTTTGGG - Intronic
1007781184 6:44255827-44255849 TGTGTGTGAAAAACCTATTCAGG + Intronic
1009458554 6:63886018-63886040 TATGGCTTCAAGACCTATATAGG + Intronic
1010978006 6:82338557-82338579 TGTCTCTCAAAGACCTTTTTAGG - Intergenic
1011934706 6:92761107-92761129 TGTGTATGAAAGAGTTATTTTGG - Intergenic
1017730065 6:157307433-157307455 TGGGTTTGAAAGAGCTATTTTGG + Intronic
1017999624 6:159567758-159567780 ATTGGCTGAAAGAGCTTTTTGGG - Intergenic
1018668657 6:166162389-166162411 GGTGGCTGCAAGACCACTTTGGG - Intronic
1020981345 7:15072740-15072762 TGGGGCTGAAAGTACTTTTTGGG - Intergenic
1021399425 7:20192617-20192639 GGTGGCTGAGAGATCTAGTTAGG - Intronic
1022639564 7:32169110-32169132 TGAGTCTGAAAGACCCATTTGGG + Intronic
1023356868 7:39375828-39375850 TTTGGCAGAAAGAGCAATTTGGG + Intronic
1026727583 7:72881485-72881507 TGTGGCTGATAGACCTAGAGGGG - Intronic
1027116258 7:75484243-75484265 TGTGGCTGATAGACCTAGAGGGG + Intronic
1027121554 7:75525950-75525972 TGTGGCTGATAGACCTAGAGGGG + Intergenic
1027275570 7:76551455-76551477 TGTGGCTGATAGACCTAGAGGGG - Intergenic
1029721276 7:102366009-102366031 TGTGGCTGATAGACCTAGAGGGG - Exonic
1030389612 7:108910301-108910323 TGTGGCTGTAAGAAAAATTTAGG + Intergenic
1035584507 8:761548-761570 TGTGGCTGAAAGGCCAGTGTGGG + Intergenic
1036053528 8:5226235-5226257 TCTGGCTGATATACCCATTTTGG + Intergenic
1037843801 8:22264614-22264636 TGTGACTGATAGTCCCATTTTGG + Intergenic
1040400564 8:47045608-47045630 GGTGGCTGAAAGCCCCAGTTGGG - Intergenic
1041846074 8:62330475-62330497 TGAGGCTGAAATACATAATTTGG + Intronic
1043203935 8:77411414-77411436 AGTGGATGCATGACCTATTTTGG + Intergenic
1044628749 8:94259428-94259450 TGTGGCTGAAAGACACTTTATGG + Intronic
1046372355 8:113325757-113325779 TGTGACTGAGAGACCCTTTTAGG - Intronic
1047049731 8:121097471-121097493 TGTTGGTGAAAGACCAATGTAGG - Intergenic
1047317516 8:123748081-123748103 TGTGGGTTAGAGACATATTTGGG + Intergenic
1047668072 8:127114405-127114427 GGTGGTTGAAAGAGATATTTAGG - Intergenic
1048770946 8:137894335-137894357 TGTGGCTCAAAGAAATAATTTGG + Intergenic
1051518359 9:17956190-17956212 AGTGGCTGTAAGACCTTCTTTGG + Intergenic
1052961044 9:34297196-34297218 TGTTACTTAAAGACATATTTTGG - Intronic
1053212419 9:36242354-36242376 TAGGGCTTAAAGTCCTATTTGGG - Intronic
1055666644 9:78559772-78559794 TGTGGCTGAAATATTTATATAGG + Intergenic
1060719403 9:125965240-125965262 TGTGGCTGAGGCTCCTATTTGGG - Intronic
1188235571 X:27726997-27727019 TGTGGTGAAAAGAACTATTTTGG - Intronic
1190471246 X:50781672-50781694 TTTGGCTGAAATAGCAATTTGGG - Intronic
1191989694 X:67020712-67020734 TGTGAATGGAAGACATATTTGGG + Intergenic
1193982108 X:88194512-88194534 TGGAGATGAAAGACCTATTCTGG + Intergenic
1194075910 X:89393747-89393769 TGTAGCTGATAGAACTATTGGGG + Intergenic
1195868331 X:109457855-109457877 TATGGCTGGAACACATATTTTGG - Intronic
1198197978 X:134384261-134384283 TGGGTCTCAAAGACCTATTCTGG - Intronic
1199140744 X:144308976-144308998 TGTGGCCGACAGACTTATGTTGG - Intergenic
1200731517 Y:6747907-6747929 TGTAGCTGATAGAACTATTGGGG + Intergenic