ID: 1088065044

View in Genome Browser
Species Human (GRCh38)
Location 11:105707145-105707167
Sequence TTTCTATTGTCATCAAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088065044_1088065046 10 Left 1088065044 11:105707145-105707167 CCTGGCTTTGATGACAATAGAAA 0: 1
1: 0
2: 7
3: 18
4: 200
Right 1088065046 11:105707178-105707200 AATGATATAGCTATTGCTACTGG 0: 1
1: 0
2: 5
3: 11
4: 140
1088065044_1088065047 13 Left 1088065044 11:105707145-105707167 CCTGGCTTTGATGACAATAGAAA 0: 1
1: 0
2: 7
3: 18
4: 200
Right 1088065047 11:105707181-105707203 GATATAGCTATTGCTACTGGTGG 0: 1
1: 5
2: 2
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088065044 Original CRISPR TTTCTATTGTCATCAAAGCC AGG (reversed) Intronic
900668638 1:3834654-3834676 TTTCCATGGTCTGCAAAGCCAGG - Intronic
902201799 1:14838960-14838982 TCTCTCTTTTCTTCAAAGCCAGG - Intronic
903721809 1:25411358-25411380 TTCTCATTGTTATCAAAGCCAGG - Intronic
905138707 1:35822920-35822942 TTTCTTTTGCCATCATACCCAGG - Exonic
905421269 1:37846932-37846954 TTTCTATAGCCATAACAGCCAGG - Intronic
908343827 1:63210990-63211012 TTTCTATTGTCATTCCACCCAGG - Intergenic
908690884 1:66779125-66779147 TTTCGATTCTCAACACAGCCTGG - Intergenic
909102867 1:71372140-71372162 TTTCTATTGTTATTAATGACTGG + Intergenic
909103279 1:71377860-71377882 TTTCCATTGTCAAGAAAGGCTGG - Intergenic
910477679 1:87624129-87624151 TTTGTATTTTCATCAGAGACAGG + Intergenic
914452177 1:147802405-147802427 TTACTATTTTCAGCAAAGTCCGG + Intergenic
916388325 1:164302380-164302402 TGTCTATTGTCAACAAGGCATGG + Intergenic
916441213 1:164826756-164826778 TATCTATTTACATCAAAGACTGG - Intronic
916988787 1:170219825-170219847 TTTCCACTGTCATAAAATCCAGG - Intergenic
918936039 1:190923607-190923629 TTTCTATTGTTATCAGAGGTAGG + Intergenic
922122251 1:222683923-222683945 TTTTTATTTTCATGAAAGGCTGG + Intronic
1064884464 10:20094562-20094584 TTTCTGATCTCATCAAAGTCTGG + Intronic
1067131098 10:43566174-43566196 TTTCTATTTTCAGCTAATCCTGG - Intronic
1067967765 10:50933043-50933065 TTACTATTGTCATGAATGTCAGG - Intergenic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1070184984 10:74052924-74052946 TTTTTTTTTTCATCACAGCCAGG - Intronic
1070712288 10:78691531-78691553 TTGATATTGTCAACAAATCCAGG + Intergenic
1070739214 10:78891677-78891699 TTTCTAATGTCATCAACCCTGGG + Intergenic
1071070470 10:81686164-81686186 TTTCTTTTTTCTACAAAGCCTGG - Intergenic
1071930030 10:90458632-90458654 TCTTTATTGTCCCCAAAGCCTGG - Intergenic
1073662951 10:105497634-105497656 TTTCTATTGTCATCAGAATAAGG + Intergenic
1076108296 10:127842077-127842099 TTCCTATGGTCAGCAAGGCCAGG - Intergenic
1076299418 10:129413606-129413628 TTATAATTGTCCTCAAAGCCAGG - Intergenic
1078432178 11:11296544-11296566 CTTCTTCTGTCATCAAAGCCTGG + Intronic
1081321499 11:41697151-41697173 TTTCTAGTGTTGTCAAAGGCTGG + Intergenic
1082084636 11:48039817-48039839 TTGCTATTGTCATCCAGGCTGGG + Intronic
1086739972 11:90354560-90354582 TTTTTATTTACTTCAAAGCCTGG - Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088526650 11:110763066-110763088 TTCTTATTGTGATCAAAACCTGG - Intergenic
1089438754 11:118496305-118496327 TGTCTATTGTCTTCTATGCCTGG - Exonic
1090006335 11:123005951-123005973 TTTGTATTTTCAGCAAAGACGGG - Intergenic
1090309262 11:125720307-125720329 TTTCTATGGATATCAAAGCCTGG - Intergenic
1090753768 11:129770761-129770783 TTTCTATTGACATAAAACACAGG + Intergenic
1090831425 11:130423412-130423434 TTTCTGTTGTCATCCAAACCAGG + Intronic
1091660350 12:2378621-2378643 TTTGTATTGTCATCATGGCCTGG + Intronic
1092594286 12:9984471-9984493 TTTTTATAATCATCAAAGTCAGG - Intronic
1092669597 12:10848129-10848151 CTCCTATTGTCCTCAAAGCCAGG + Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096360707 12:50983664-50983686 TTTGTATTTTCAGTAAAGCCAGG - Intronic
1096370920 12:51068321-51068343 TTTCTATTTTCAGTAAAGACAGG + Intronic
1096568643 12:52503980-52504002 TTTCTATTGTTTTCTTAGCCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1099667705 12:85653369-85653391 TTTATGCTGTCATCAAAGCTGGG + Intergenic
1107110414 13:36691485-36691507 TGTCTCTTGTAATAAAAGCCTGG - Intronic
1108685038 13:52812062-52812084 TATCCATTCTCATAAAAGCCTGG - Intergenic
1109458930 13:62628106-62628128 TTTCTACTGTCTTCAAAGCAAGG + Intergenic
1109894840 13:68672491-68672513 TTTCTTTTGTCATAAAATACTGG - Intergenic
1109949687 13:69484092-69484114 TTTCTATTTTCCTGAAATCCAGG - Intergenic
1110288952 13:73782008-73782030 TTTCTACTGTTTTCTAAGCCAGG + Intronic
1111069371 13:83144030-83144052 TTTCTATTGTCACCAGTGACAGG - Intergenic
1111909447 13:94294000-94294022 TTTCAATCCTCATCAAAGGCAGG + Intronic
1118372084 14:65145802-65145824 ATTCTATTCTGATCCAAGCCAGG - Intergenic
1118988443 14:70777000-70777022 TTTCTATTTTCAGCAGAGACAGG + Intronic
1119227831 14:72957541-72957563 TTACTATTCTCATCAACACCAGG + Intronic
1119863771 14:77956285-77956307 CGTCTATTGTCATCACAGCCTGG + Intergenic
1120835349 14:89034195-89034217 TTTCTCTTTTCATCATATCCTGG + Intergenic
1122076142 14:99236056-99236078 TTTCTTTAATCATCAAAGGCAGG - Intronic
1127768461 15:62210704-62210726 TTTCTATAAACATCAAAGTCTGG - Intergenic
1128307653 15:66610573-66610595 TTTCAATTGTCAACAGACCCAGG - Intronic
1129914107 15:79253427-79253449 TTACTATTGTCATAAGTGCCAGG + Intergenic
1129962222 15:79697615-79697637 GTTATATTGTCATGAAATCCAGG - Intergenic
1130198656 15:81804993-81805015 TTTCATTAGTCATAAAAGCCAGG - Intergenic
1130627805 15:85533953-85533975 TTTCTATGGTCATCATATTCAGG + Intronic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1133126572 16:3651254-3651276 ATTATATTGACATCTAAGCCAGG - Intronic
1134107697 16:11495550-11495572 TTTCTATTTTTAGTAAAGCCGGG + Intronic
1135611065 16:23867594-23867616 TGTCTATTTTCATCAAGTCCTGG + Intronic
1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG + Intergenic
1140213351 16:72987963-72987985 TTTCTTTTGGTATCAAATCCAGG - Intronic
1140289888 16:73643662-73643684 TTTCCATTGACATCAAGTCCAGG + Intergenic
1140707919 16:77648307-77648329 TTTCCTTTCTCATGAAAGCCTGG + Intergenic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1144245857 17:13363775-13363797 TATCTATTGTCATGAAATCCAGG + Intergenic
1146042867 17:29473462-29473484 TTTCTATTTTCAGCAGAGACGGG - Intronic
1148287179 17:46404694-46404716 TTTGTATTTTCATCAGAGACAGG - Intergenic
1148309349 17:46622282-46622304 TTTGTATTTTCATCAGAGACAGG - Intronic
1148484905 17:47984400-47984422 TTTCTTTTGTCCTCAACTCCCGG - Intergenic
1148822410 17:50367213-50367235 ACTCTATTGTCATCCCAGCCAGG - Intergenic
1149373765 17:56022849-56022871 TTTCTATTGTCTTCAGAGTATGG + Intergenic
1149806572 17:59622876-59622898 GATCTCTTGTCATCAAAGCTTGG + Intronic
1150902237 17:69293401-69293423 TCTCTTTGGTGATCAAAGCCAGG + Intronic
1151955998 17:77380565-77380587 TTTCCTGTGTCCTCAAAGCCAGG + Intronic
1152191809 17:78892725-78892747 TTTCTATTGTCACAAATGCAGGG + Intronic
1153123452 18:1760986-1761008 TTTCCAGTTTCTTCAAAGCCAGG + Intergenic
1155339441 18:24799168-24799190 GTTCTATTCCCAGCAAAGCCTGG - Intergenic
1157578903 18:48761954-48761976 TTTCTATTTTCATAAGAGGCTGG + Intronic
1160158739 18:76454730-76454752 CTTCTTTTATCTTCAAAGCCTGG - Intronic
1160671005 19:363362-363384 TTTCTATTTTCAGCAGAGACGGG + Intronic
1166688184 19:44808461-44808483 TTTCAATGGTCTTCAAATCCAGG - Intergenic
1168328617 19:55552536-55552558 TTTCTATTGTTTTTAAAGACAGG - Intergenic
925863814 2:8206014-8206036 CTTGTTTTGTCCTCAAAGCCAGG + Intergenic
926954429 2:18279101-18279123 TTTCTATTTTTATCAAAGTGAGG + Intronic
930482129 2:51961810-51961832 TTTGTATTGTCAATAAAGACAGG - Intergenic
930686806 2:54318215-54318237 TTTCAAATGTCAGCAAACCCTGG + Intergenic
932053377 2:68420710-68420732 TTTCCTTTGTCATCAATGTCTGG + Intergenic
932969672 2:76525270-76525292 TTTCTATTGTCATAATACCCAGG - Intergenic
935456195 2:103270149-103270171 TTTCTATTGTCACCACAGATGGG + Intergenic
937638134 2:124179917-124179939 TTTGTATTTCCATCAAAACCAGG + Intronic
939504855 2:143032504-143032526 TTTTTATAGTTATCAAATCCAGG - Intronic
939782347 2:146464888-146464910 CTTCTATTCTCATCCAATCCTGG + Intergenic
940298634 2:152156574-152156596 TTTATACAGTAATCAAAGCCTGG - Intronic
940792699 2:158045145-158045167 TTCCTCCTGTCATCTAAGCCTGG - Intronic
941162522 2:162052145-162052167 TTTCTATTGTTAGCAGAGACAGG - Intronic
941917511 2:170822259-170822281 TTTCTAATGTAATTACAGCCAGG + Intronic
942866691 2:180685135-180685157 TATCTAATGTCATCAAATTCTGG + Intergenic
943795236 2:191984434-191984456 TTTCTAGTATCATCAAAGGAAGG - Intronic
944006341 2:194912456-194912478 TGTCTAATGTCATCAAAACAAGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944513995 2:200492840-200492862 TTACTATTGCCAGTAAAGCCTGG + Intronic
946268950 2:218573144-218573166 TTTCTATTTTTAGCAAAGACGGG - Intronic
1169292865 20:4367629-4367651 TTTCAATTATGGTCAAAGCCAGG + Intergenic
1169447469 20:5684459-5684481 TTTTTATTGCCAGCAAAGCCAGG - Intergenic
1170377152 20:15712603-15712625 TTTATTTTGTCATCCAAGCTTGG + Intronic
1171141427 20:22747146-22747168 CTGCTAGTGTCAGCAAAGCCAGG + Intergenic
1172417740 20:34784907-34784929 TTTCTATTTTCAGTAAAGACGGG - Intronic
1174074998 20:47928423-47928445 TTTTTAATGCCTTCAAAGCCAGG + Intergenic
1175473471 20:59251272-59251294 TTTCTGGTGTCACCACAGCCTGG - Intronic
1177073063 21:16535232-16535254 TTTCTAAAGTCAGCACAGCCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178276584 21:31243932-31243954 TGTCTTTTATCATCCAAGCCAGG - Intronic
1185413020 22:50695808-50695830 TTCCTAGTTTCATCAGAGCCAGG + Intergenic
949517377 3:4819957-4819979 TTTCTACAGTCAGCCAAGCCTGG - Intronic
949785397 3:7734635-7734657 TTTCTTGTGTCAACAAATCCAGG + Intronic
950373078 3:12547510-12547532 TTTCTCTTGTCACCCAAGCTGGG - Intronic
956581586 3:70819927-70819949 TTTCTCTTCCCATCTAAGCCAGG - Intergenic
956800644 3:72754983-72755005 TTTCTACTGTTATAAAAGACAGG - Intronic
957190822 3:77007145-77007167 TTCCAACTGGCATCAAAGCCTGG + Intronic
957847179 3:85753250-85753272 TTTCTTGCTTCATCAAAGCCAGG - Intronic
960424931 3:117494919-117494941 TTACTTCTGACATCAAAGCCTGG - Intergenic
963451018 3:145482217-145482239 TTTCTCTTGACTTCAGAGCCAGG - Intergenic
965164111 3:165172954-165172976 TTTGTATTGACATAAAAGCTAGG + Intergenic
966170071 3:177069914-177069936 TTTCAACTGTGATCTAAGCCAGG + Intronic
969598619 4:8162749-8162771 TGTCTATTGAAAACAAAGCCAGG + Intergenic
970551261 4:17183956-17183978 TTTCCTTTGACATTAAAGCCTGG - Intergenic
971374296 4:26044246-26044268 TTTCTAATTTAATCAAAGACAGG + Intergenic
971886205 4:32451562-32451584 TTTGTCTTGTCACCAAAGACTGG - Intergenic
972381729 4:38525848-38525870 TTTCTATTTTCATAAAAGCAGGG + Intergenic
973725675 4:53773212-53773234 TCTCTATTGTAATCAAAACAGGG - Intronic
974268772 4:59622423-59622445 TATTTATAGTCATCAAAACCAGG + Intergenic
974314383 4:60258860-60258882 TTTCAATTGCCATCAATGTCAGG + Intergenic
978279490 4:106993077-106993099 TTTCTACTCTTCTCAAAGCCTGG + Intronic
979510878 4:121552148-121552170 TTTCAAGTGCCATCAAAGCTAGG + Intergenic
980115647 4:128676774-128676796 TTTCTCTTGTCCTCAAAAACTGG + Intergenic
980218998 4:129890769-129890791 TTTGTATTGTCATCACTGTCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
981640351 4:146935174-146935196 TTCCTACTGTCATCTAAGCATGG - Intronic
981784129 4:148458425-148458447 TTTCCCTTGTCATGAATGCCTGG + Intergenic
983924520 4:173385720-173385742 TTACTACTGCAATCAAAGCCTGG - Exonic
984154920 4:176184585-176184607 TTTGTATTTTCAACAATGCCTGG + Intergenic
984191800 4:176614672-176614694 TTTCTATGGAGATCTAAGCCAGG + Intergenic
985182958 4:187285259-187285281 TTTCTATTCACATCAAACCGGGG + Intergenic
987026773 5:13934904-13934926 TTTCAAATGTCACTAAAGCCAGG + Intronic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
993089171 5:83402471-83402493 TTTCTATTATCATGAAAGCAAGG - Intergenic
993157466 5:84243749-84243771 TTTTTATTTTAATCAAGGCCTGG - Intronic
993422911 5:87723631-87723653 TTTCTATTCTTATTAAAGACGGG + Intergenic
995168338 5:109075274-109075296 TTTCTGTTGTTATCTAAGCATGG + Intronic
995176093 5:109179270-109179292 TTTCTATTGAGGTCAAAGCAAGG - Intronic
995581932 5:113611570-113611592 TGTCTAATGGCAGCAAAGCCAGG - Intergenic
996569975 5:124922763-124922785 TTTCTATTCTATTGAAAGCCTGG - Intergenic
997906863 5:137825990-137826012 TTTCTGTTGTAATGAAAGGCAGG - Intergenic
1000920938 5:167136355-167136377 ATTCTATTAGCATCAATGCCTGG - Intergenic
1000983208 5:167839215-167839237 TTTCTATTCTCATGAAAAGCAGG - Intronic
1004291014 6:14367357-14367379 TTTGTATTGCTATCAAAGGCAGG + Intergenic
1004521449 6:16364685-16364707 TTTCTATTGGGCTCAATGCCTGG - Intronic
1007420040 6:41713717-41713739 TTTCTATTCTCCCCAGAGCCAGG + Intronic
1010909000 6:81529990-81530012 CTTCTATTGTCCTGAAGGCCCGG - Intronic
1011432199 6:87299656-87299678 TTTCTGTTGTCACCAAAATCTGG - Intronic
1012664398 6:101949280-101949302 TTTCTATTATAATCAAATCTAGG - Intronic
1014599892 6:123398176-123398198 TTTCTATTTTCAGTAAAGTCAGG + Intronic
1016121662 6:140350139-140350161 TTTATTTTGACATCAAAACCTGG + Intergenic
1017930449 6:158949509-158949531 TTTGTATTTTTTTCAAAGCCAGG + Intergenic
1018098293 6:160412713-160412735 TGTCTATAGTCCTCATAGCCAGG + Intronic
1018356244 6:163020898-163020920 TTGCTGTTGTCTCCAAAGCCTGG + Intronic
1018752536 6:166819982-166820004 TGTGTTTTGTCAACAAAGCCTGG + Intronic
1019140690 6:169940513-169940535 GTGCCATTGTCATCACAGCCTGG - Intergenic
1022817308 7:33926135-33926157 TTTCTGTTCCCATCAAAACCTGG + Intronic
1023258779 7:38337606-38337628 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259309 7:38342270-38342292 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023259767 7:38346591-38346613 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023260242 7:38350920-38350942 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1023261219 7:38360071-38360093 TTTCTGCTGTCATCACAGCTGGG + Intergenic
1024125152 7:46287043-46287065 ATTCTACTTTCCTCAAAGCCTGG + Intergenic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1031426382 7:121610487-121610509 TTTCTATTCTGATCAAACCTGGG - Intergenic
1032709513 7:134449793-134449815 TTTTTATTGTAATGACAGCCTGG - Exonic
1032929844 7:136653809-136653831 TTTCTACTAGGATCAAAGCCTGG + Intergenic
1033463547 7:141569360-141569382 TTTGTATTTTCATTAAAGACGGG - Intronic
1035338650 7:158146390-158146412 CATCTATTGTGATCAAAGCCTGG + Intronic
1035981149 8:4373794-4373816 TTGTTATAGTCGTCAAAGCCTGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1038905875 8:31902546-31902568 TTTCTATAGTGATAATAGCCTGG - Intronic
1041702643 8:60808374-60808396 TTTCTTTAGTCATCATGGCCTGG + Intronic
1042216057 8:66430170-66430192 TTTCTCTTGCCACCCAAGCCAGG - Exonic
1044762293 8:95533530-95533552 TTGCTTTTGTCACCCAAGCCGGG - Intergenic
1045351718 8:101347134-101347156 TCTATTTTGTCATCAGAGCCAGG - Intergenic
1045723316 8:105139935-105139957 TTTCTTTTCTGATCAGAGCCAGG - Intronic
1045740062 8:105347295-105347317 TTTTTATTGACATCAATGACTGG - Intronic
1047948932 8:129911773-129911795 TGTATAATGTCCTCAAAGCCTGG - Intronic
1048358940 8:133678507-133678529 TTTTTATTATCATAAAAGCATGG - Intergenic
1048563172 8:135564844-135564866 TTTCTTTTGTAATCACACCCAGG + Intronic
1049262754 8:141648617-141648639 TTGCTATTGTCACCATAACCAGG - Intergenic
1052895271 9:33741790-33741812 TTTCTATTGACATAAAACACAGG + Intergenic
1053091000 9:35276395-35276417 TTTCTATTGTACTCAAGGCCAGG - Intronic
1053250124 9:36567273-36567295 TTTCTATTATTTTCAAGGCCTGG + Intergenic
1055486541 9:76761541-76761563 TATCTCTGGACATCAAAGCCCGG + Intronic
1056172792 9:84004393-84004415 TTCATATTGTCATTAAAGACTGG + Intergenic
1057408835 9:94798278-94798300 GTACCATTGTAATCAAAGCCTGG - Intronic
1058473329 9:105303735-105303757 TTTCTGTTGTCCTCAATTCCAGG - Intronic
1059469134 9:114490911-114490933 CTTCAATTATCCTCAAAGCCTGG + Intronic
1187880223 X:23840373-23840395 TTTCTTTTGTTTTAAAAGCCAGG - Exonic
1188688474 X:33099370-33099392 TTTCTATTGTCCCCAGAGCCAGG + Intronic
1194767896 X:97863853-97863875 TTTCTATTATAAGCAAATCCTGG + Intergenic
1195909333 X:109874063-109874085 TTGCTAAAGTCATCTAAGCCAGG - Intergenic
1197353351 X:125403840-125403862 TTACTTTTGTCATCAATGCCTGG + Intergenic
1199566742 X:149223349-149223371 TTACTAGTGTCATACAAGCCTGG + Intergenic
1201264747 Y:12194846-12194868 TTTGTATTTTCATTAAAGACAGG + Intergenic