ID: 1088070274

View in Genome Browser
Species Human (GRCh38)
Location 11:105775097-105775119
Sequence CTGGGCTTTAAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1141
Summary {0: 1, 1: 3, 2: 27, 3: 245, 4: 865}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088070274 Original CRISPR CTGGGCTTTAAGATGGAGGA AGG (reversed) Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900783354 1:4632056-4632078 CTGGCTTTGAAGACGGAGGAGGG - Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901826031 1:11861936-11861958 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
902225456 1:14993869-14993891 CTGGGCTTGAAGGATGAGGAGGG + Intronic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902610363 1:17593542-17593564 CTGGCCTTGGAAATGGAGGACGG + Intronic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903677870 1:25076046-25076068 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904299023 1:29542209-29542231 CAGGACTTTAAGAAGAAGGATGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905526355 1:38642943-38642965 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
905737584 1:40340517-40340539 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
906356593 1:45111665-45111687 CTGGCATTGAAGGTGGAGGAAGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
907653041 1:56314335-56314357 CTGGTGTTGTAGATGGAGGAAGG + Intergenic
907691393 1:56670441-56670463 CTAGGCTTCAGGATGAAGGAAGG + Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908022202 1:59909483-59909505 CTGGCTTTGAAGATGAAGGAGGG + Intronic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908808304 1:67953534-67953556 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
908871891 1:68622622-68622644 CTGAGTTTGAAGATAGAGGAAGG - Intergenic
909072848 1:71017275-71017297 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
909369506 1:74867699-74867721 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
909454806 1:75838249-75838271 CTGGCTTTAAAGATAGAGGAAGG - Intronic
909979570 1:82082611-82082633 CTAGTTTTGAAGATGGAGGAAGG - Intergenic
910047572 1:82936388-82936410 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910205170 1:84742531-84742553 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910400438 1:86832705-86832727 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
910810937 1:91235660-91235682 CTGGCCTTGAAAATGGAAGAAGG - Intergenic
910841735 1:91567846-91567868 CTTGGCTTCAACATGGAGGTGGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911454181 1:98102589-98102611 CTGGGACTTAAGGTTGAGGAAGG + Intergenic
911716814 1:101142622-101142644 CTGGCTTTTAAGACAGAGGAAGG - Intergenic
912015760 1:105033500-105033522 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
912024542 1:105151481-105151503 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
912454721 1:109789781-109789803 CTGGGGTTTACTATGGAGGGTGG + Intergenic
912999106 1:114562100-114562122 CAGGCCTTAAAGATGAAGGAAGG - Intergenic
913204838 1:116528808-116528830 CTGGGCTTTAAGTAAGAAGAGGG - Intronic
913223999 1:116682665-116682687 CTGAGCTTGAGGATGGGGGAGGG + Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
914050115 1:144124457-144124479 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
914129067 1:144840994-144841016 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915168051 1:153959486-153959508 CTGTGCTTTGAGAAAGAGGAAGG + Exonic
915647320 1:157282489-157282511 TTGGCCTTGAAGATGGAGTAAGG - Intergenic
915663329 1:157422021-157422043 GTGGCCTTGAAGATGGAGTAAGG + Intergenic
915725104 1:158011694-158011716 GTGGGTTTTAAGGTGAAGGAGGG + Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
916777712 1:167985412-167985434 CTGGGTTTGAAGATAGAGGAAGG - Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917711313 1:177688168-177688190 GTGGGCTTTGAGTTGGGGGATGG + Intergenic
917717326 1:177751690-177751712 CTGGGCTTTCAGATGGTTGCAGG - Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918418252 1:184335016-184335038 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
918442054 1:184577292-184577314 CTGGCGTTGAAGATGGAGAAAGG + Intronic
919482786 1:198109885-198109907 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
920521602 1:206631658-206631680 TTGGTCTTGAAGATGGAGGAGGG - Intergenic
920584749 1:207146679-207146701 GTGGGCAGTAAGATGGAGAAGGG + Intergenic
921549236 1:216512908-216512930 CTGGCTTTAAAGACGGAGGAGGG + Intronic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922346197 1:224698676-224698698 CTGGGCTTTAAAAGGAAGGTAGG + Intronic
922601794 1:226861594-226861616 CTGGCCTTGAAGATTGAGGATGG - Intergenic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923567637 1:235088340-235088362 CTGGGCTTGGAGCTGGAGGCTGG + Intergenic
924140154 1:241013621-241013643 CTGAGCTATGAAATGGAGGAGGG - Intronic
924213103 1:241790976-241790998 CTGGCTTTGAAGATGAAGGAAGG - Intronic
924530353 1:244888641-244888663 CTGGCTTTGAACATGGAGGAAGG + Intergenic
924718309 1:246599453-246599475 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1063091227 10:2867632-2867654 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1063690639 10:8283938-8283960 CTGGGTTTTTAGAAAGAGGAAGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064254775 10:13734212-13734234 CGGGGCTTCAGGATGGAGAAGGG - Intronic
1064982631 10:21179775-21179797 CTGGCCTTGAAGACGGAGGAAGG + Intergenic
1065417055 10:25499810-25499832 ATAGGCTTTGACATGGAGGATGG + Intronic
1065698355 10:28401164-28401186 CTGGCCTTGGAGATGGAGGAAGG - Intergenic
1065784674 10:29202322-29202344 CTGGGCTTCGTGATGGAGTAAGG - Intergenic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1067700969 10:48571780-48571802 CTGGGCTATAAGGTCCAGGAAGG + Intronic
1068006223 10:51394512-51394534 CTGGATTTTAAGAGGCAGGAGGG + Intronic
1068041573 10:51831701-51831723 CTGGCCAGTAGGATGGAGGAAGG + Intronic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068566602 10:58582769-58582791 CTGGCTTTAAAAATGGAGGAAGG - Intronic
1068780755 10:60916934-60916956 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069018726 10:63462671-63462693 TTGGCTTTTAAGATGGAGGAAGG + Intronic
1069282354 10:66670483-66670505 GCTGCCTTTAAGATGGAGGAAGG - Intronic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070472424 10:76796004-76796026 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
1070593810 10:77818700-77818722 CTGGGCTGTAACTTGGAAGAGGG - Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1070655448 10:78268004-78268026 GCTGGCTTGAAGATGGAGGAAGG + Intergenic
1070658522 10:78288093-78288115 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1070681122 10:78449821-78449843 GTGGGCTTTAAGTTGGGGGGAGG - Intergenic
1071061120 10:81571312-81571334 CTGGGCTTGCATATGGAGCATGG - Intergenic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071806104 10:89122911-89122933 CTGGCTTTGAAGCTGGAGGAAGG - Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072169594 10:92846976-92846998 CTAGCTTTGAAGATGGAGGAAGG + Intronic
1072513888 10:96157655-96157677 ATGGGCTTCAAGATGATGGATGG + Exonic
1072751797 10:97986078-97986100 CTGGGCTCTGGGAAGGAGGAAGG + Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1072911889 10:99509497-99509519 CTGGCTTTGAAGATGGAGGCAGG + Intergenic
1073069933 10:100786998-100787020 CTGGACTTTAAGAGGTATGAGGG + Intronic
1073080293 10:100855530-100855552 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1073630775 10:105146509-105146531 CTGGTCTTTCAGATGGAGTCAGG - Intronic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074471007 10:113726705-113726727 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1074494038 10:113963434-113963456 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1074888787 10:117717626-117717648 CTGGTCTTTAAGAAGTAAGAGGG + Intergenic
1074914397 10:117941540-117941562 CTGGCCTTGAAGGTGGAGGAAGG - Intergenic
1075068819 10:119307512-119307534 CTGGTTTTGAAGGTGGAGGAAGG + Intronic
1075112522 10:119598613-119598635 CTTTTCTTGAAGATGGAGGATGG - Intergenic
1075201787 10:120410703-120410725 CTGGGCTATATCAAGGAGGAGGG + Intergenic
1075264362 10:120988202-120988224 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075508850 10:123052343-123052365 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1075515653 10:123106044-123106066 CTGGCTTTGAAGATGCAGGATGG + Intergenic
1075580066 10:123610727-123610749 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1075765248 10:124887790-124887812 CTGGGCCTTAAGAAAGAGTAAGG - Intergenic
1075903423 10:126061689-126061711 TTGGCCTCGAAGATGGAGGAAGG + Intronic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076120470 10:127932972-127932994 CGGGCTTTAAAGATGGAGGAAGG - Intronic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076411517 10:130254872-130254894 CAGGGCTTTAGGATGGAGACTGG + Intergenic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1077289624 11:1782894-1782916 CTGGACTTGAAGTCGGAGGAGGG + Intergenic
1077290301 11:1786636-1786658 CTGGCTTTGAAGATGGAGGTGGG - Intergenic
1077482434 11:2822101-2822123 CTGGCTTTGAAGACGGAGGAGGG + Intronic
1077515345 11:2998437-2998459 CTGGGGTTAAAGATGGTGGGGGG - Intergenic
1077580875 11:3416503-3416525 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1077992436 11:7424027-7424049 CTGGGATTTAGCATGGAGGGAGG + Intronic
1078064977 11:8072321-8072343 CTAGGCTCTAGGAGGGAGGAAGG - Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078511301 11:11986139-11986161 CCTGGCTTGAAGATGGCGGAGGG - Intronic
1078565345 11:12409599-12409621 CTGGCTTTTAAGATGGAGTAAGG + Intronic
1078639821 11:13084268-13084290 CTGGGATTTAGTATGGAGGATGG + Intergenic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079028205 11:16965611-16965633 CTGGGCTTTGAGCTGGAGTAGGG - Intronic
1079345133 11:19645219-19645241 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1079624856 11:22604769-22604791 CTGGGCTATAAGCTGAGGGAGGG - Intergenic
1079641722 11:22813976-22813998 CTGATTTTGAAGATGGAGGAAGG - Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1080167074 11:29251560-29251582 CTGGGCTAGAACATGGAGAAAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080717959 11:34822453-34822475 GTGGGCTATAAGATGGGGAATGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081491731 11:43574775-43574797 CTGGTCTTTGAGAGGGAGAAAGG + Intronic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1083671848 11:64304355-64304377 CTGAGTGTTAAGGTGGAGGATGG - Intronic
1083759558 11:64808133-64808155 CTGTGCTTTAACATGGGGAAAGG + Intronic
1083983170 11:66191186-66191208 ATGGCCTTGAAGATGGAGGGAGG - Intronic
1084092318 11:66886679-66886701 CTGGGTTTTAAGGTGAACGATGG + Intronic
1084237802 11:67799337-67799359 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084612027 11:70209326-70209348 GTGGGCCTGAAGATGGAGGGAGG - Intergenic
1084834606 11:71793496-71793518 CTGGGCTGTGAGGGGGAGGAGGG - Intronic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1087179973 11:95132062-95132084 CTGGGCTTTGAGGTAGAGGTTGG + Exonic
1087332930 11:96805619-96805641 CTGGCTTTGAAGACGGAGGATGG - Intergenic
1087430419 11:98046499-98046521 CTGGCATTTAAGATGGAGCACGG + Intergenic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1087956974 11:104300430-104300452 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1088070274 11:105775097-105775119 CTGGGCTTTAAGATGGAGGAAGG - Intronic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088470829 11:110186521-110186543 GTGAGCTTTAAGATGGAAAATGG + Intronic
1088680061 11:112232309-112232331 CTGGGATTGAAGATGAAGCAAGG + Intronic
1089043763 11:115480852-115480874 CAAGGCTTTAAGAAGGAGGGTGG - Intronic
1089068815 11:115682718-115682740 CTGGCTTGGAAGATGGAGGAAGG + Intergenic
1089121736 11:116140816-116140838 GTTGGCTTGAAGATAGAGGATGG - Intergenic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090436160 11:126688096-126688118 TTGGGCTTGAAGATGGATGGAGG + Intronic
1091312142 11:134582163-134582185 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1091531222 12:1357843-1357865 CTGGGGATGAAGTTGGAGGAGGG - Intronic
1091950304 12:4587290-4587312 CTGGGCTTTAACCGAGAGGACGG - Intronic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1092408475 12:8236934-8236956 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092673363 12:10888088-10888110 CTGGCATTGAAGATGGAAGAAGG - Intronic
1092702414 12:11246944-11246966 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092711993 12:11348699-11348721 CTGGCATTGAAGATGGAAGAGGG + Intergenic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093364660 12:18278320-18278342 CTGGCTTTTAAGATGAAGAAAGG - Intronic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1093719186 12:22418678-22418700 CTGGTTTTGAAGATGGAGGGAGG + Intronic
1094039630 12:26109509-26109531 CTTGGCTTTGAGCAGGAGGAGGG + Intergenic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1096116695 12:49059513-49059535 CTGGCCTTTAGGTTGGAGAAGGG - Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097677579 12:62619602-62619624 CTGGCTTTCAAGATGAAGGAAGG + Intergenic
1097746749 12:63311634-63311656 CTGGGCTTACAGAGGGAGAAAGG + Intergenic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099293454 12:80801384-80801406 CTCGTTTTGAAGATGGAGGAAGG + Intronic
1099811424 12:87587322-87587344 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1099833251 12:87873112-87873134 CTGGGTTGGAAGACGGAGGAAGG - Intergenic
1099863565 12:88249645-88249667 CGTGCTTTTAAGATGGAGGAAGG + Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1100874008 12:98943567-98943589 ATGGTCTTGAAGATGGAGGAAGG - Intronic
1101407708 12:104443271-104443293 GTGGCTTTGAAGATGGAGGATGG + Intergenic
1101828360 12:108238456-108238478 CTGGCTTTTAAGATGGATGGAGG - Intronic
1102066811 12:109983862-109983884 CTGGGCTGTAAGGTGGAGTGAGG + Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102445757 12:113001601-113001623 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1102787097 12:115613862-115613884 CTGGCCTTGAAGGTGGAGGACGG + Intergenic
1102814208 12:115849886-115849908 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1102940406 12:116936546-116936568 CTGGCCTTGAAGGTGGAGGAAGG + Intronic
1102991632 12:117320378-117320400 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103936175 12:124478117-124478139 CTGGCCTTGAACCTGGAGGAAGG + Intronic
1103992296 12:124807356-124807378 CTGGCCTCAAAGGTGGAGGAAGG + Intronic
1104074783 12:125379365-125379387 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104539713 12:129652579-129652601 CTGGGTTTTAGGATGCAGGAAGG + Intronic
1104551464 12:129761234-129761256 CTGGGGTCTAAGATGGGGGCTGG - Intronic
1104695178 12:130858055-130858077 CTGGCACTGAAGATGGAGGATGG - Intergenic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105758505 13:23491951-23491973 GTGTGCTTTAATAAGGAGGATGG - Intergenic
1106295526 13:28410203-28410225 CTGAGCTTTAAGTAGGGGGAGGG - Intronic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106670652 13:31901056-31901078 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1106887673 13:34207240-34207262 CTGGCTTTTAAGGTGGAGTAAGG - Intergenic
1107351547 13:39520062-39520084 CTGGGCTCCCAGATGGAGGGTGG - Intronic
1107366248 13:39680741-39680763 CTGGCTTGGAAGATGGAGGAAGG - Intronic
1107691775 13:42960775-42960797 CTGGCTTTGAAGATGTAGGAAGG - Intronic
1107788367 13:43976801-43976823 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108033071 13:46257124-46257146 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1108348320 13:49567481-49567503 CGGGGTTTGAAGGTGGAGGAGGG - Intronic
1108597526 13:51962303-51962325 CTGGGCTGGAAGCTGGAGGCTGG - Intronic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1108714851 13:53068952-53068974 CTGGGCTTTGTGAGGGTGGAGGG + Intergenic
1109019258 13:57064526-57064548 CTAGGCTTCCAGATGGAGGAGGG - Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1109365322 13:61348282-61348304 CTGGCATTGAAGATGAAGGAAGG - Intergenic
1109821581 13:67664183-67664205 CTGGGCTTTCAGAGGGCGTAAGG + Intergenic
1110068026 13:71133533-71133555 CTGGTTTTCAAGATGGAGGTAGG + Intergenic
1110268477 13:73566795-73566817 CTGGCCTTGAACATGGAGGAAGG + Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110409221 13:75185480-75185502 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1110442311 13:75539034-75539056 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1110597784 13:77338100-77338122 CTGGCTTTAAAGGTGGAGGAAGG + Intergenic
1110731013 13:78878183-78878205 CAGGTCTTGAAGATGGAGGAAGG - Intergenic
1110837525 13:80101599-80101621 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1111629927 13:90837545-90837567 ATGGGTTTGAAAATGGAGGAGGG - Intergenic
1111785052 13:92776206-92776228 CTGGCCTTGAAGATAGAGGAGGG - Intronic
1111819596 13:93196280-93196302 CTGTGTTTTGAGATGGATGAAGG - Intergenic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112927429 13:104693823-104693845 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1112938457 13:104830156-104830178 CTGGGTTTAAAGAAGAAGGAAGG - Intergenic
1112998608 13:105604596-105604618 CTGGGCCTTCACATGGTGGAAGG + Intergenic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113096284 13:106667219-106667241 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113343975 13:109455713-109455735 CTGGCTTTCAAGATGGAGAAAGG - Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113531654 13:111031950-111031972 CTCAGCTTGAGGATGGAGGAAGG + Intergenic
1113859054 13:113469215-113469237 CTAGTCTTTCAGAAGGAGGATGG - Intronic
1113917103 13:113880983-113881005 CTGGGCTGTGTGATGGAGGCTGG - Intergenic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1114345915 14:21794905-21794927 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1115230134 14:31151636-31151658 CAGCACTTTGAGATGGAGGAGGG - Intronic
1115495710 14:34002418-34002440 CTGGCTTTGACGATGGAGGAAGG + Intronic
1115697650 14:35917629-35917651 TTGGTTTTGAAGATGGAGGAAGG + Intronic
1116001898 14:39252359-39252381 CTGGCTTTGAAAATGGAGGATGG + Intronic
1116596543 14:46855531-46855553 CTGGTTTCCAAGATGGAGGAAGG + Intronic
1116739739 14:48739272-48739294 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117152270 14:52901617-52901639 CTGGCTTTGAAGATAGAGGAAGG + Intronic
1117814205 14:59580491-59580513 CTAGTTTTGAAGATGGAGGAAGG + Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118270933 14:64341439-64341461 CTAGTTTTAAAGATGGAGGAAGG + Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119433170 14:74581508-74581530 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1120061496 14:79988719-79988741 CTGAGCTTGAAGATGGAGAAAGG - Intergenic
1120219816 14:81719488-81719510 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1120959461 14:90111239-90111261 CTGGGGTGTCAGATAGAGGATGG + Intronic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121958671 14:98238458-98238480 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1122014588 14:98783612-98783634 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122373183 14:101240630-101240652 CTGGCTTTGAAGACGGAGGATGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1122866777 14:104609449-104609471 CTGGCTTTGAAGATGGAGCAAGG - Intergenic
1123419978 15:20123720-20123742 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123529199 15:21130256-21130278 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1123797562 15:23787593-23787615 CTGGGCTTTGAAATGGATTAAGG + Intergenic
1124205239 15:27712932-27712954 CTGGCTATAAAGATGGAGGAGGG + Intergenic
1124291938 15:28459973-28459995 CTGGGCTTTAAAATGGAGCCAGG + Intergenic
1124434599 15:29636440-29636462 CTGGGCTCTAAGCTGCAGGGCGG - Intergenic
1125318701 15:38459195-38459217 CTGGGCTTAAAGATGCACAAGGG + Intronic
1125591662 15:40858000-40858022 CTGGGCCCTAACATGGAGGTAGG - Exonic
1126074982 15:44900475-44900497 CTGGCCCTTGAGATGGAGGAAGG + Intergenic
1126083382 15:44987341-44987363 CTGGCCCTTGAGATGGAGGAAGG - Intergenic
1126318113 15:47392496-47392518 CTGGCTTTGAAGACGGAGGAAGG + Intronic
1126424722 15:48515078-48515100 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1126465864 15:48961441-48961463 CTGGGCCTTATGGAGGAGGAAGG - Intronic
1126589038 15:50320837-50320859 TTGGCCTTAAAGATGGAGGAAGG + Intronic
1126729547 15:51668731-51668753 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
1126869197 15:52969568-52969590 CTGGCATTGAAGTTGGAGGAAGG + Intergenic
1127120304 15:55766164-55766186 CTGGCCTTGAAGATGGAAAAAGG - Intergenic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127264895 15:57353332-57353354 CTGGCCTTTAAGATGGAGGAAGG + Intergenic
1127272679 15:57415425-57415447 CTGGCGTTGAAGATGGAGGAAGG + Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128336233 15:66787394-66787416 CTGGGCCTGAAGGTGGGGGAGGG - Intergenic
1128414180 15:67428921-67428943 CTGGCCTTGAACAAGGAGGAAGG + Intronic
1128625729 15:69201009-69201031 CTGGCTTTGAAGATGAAGGAGGG - Intronic
1128810665 15:70569587-70569609 CTGGGGTTAAAGGTGGAGGAAGG + Intergenic
1128934263 15:71731972-71731994 CTGGCTTTGAAGGTGGAGGAAGG - Intronic
1129279924 15:74476603-74476625 CTGGGTTTTGAGATGGATGTAGG + Intergenic
1129468232 15:75736184-75736206 CTTGTCTGTAAAATGGAGGAAGG - Intergenic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130628492 15:85540465-85540487 CTGTGCTTTAGGATTGTGGATGG - Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130764652 15:86857702-86857724 CTAGGCTCTGAGATGCAGGAGGG + Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1130957408 15:88637467-88637489 CAGGGCATGAAGATGGAGGTGGG + Intronic
1130959672 15:88651515-88651537 CTGGCTTTGAAGATGGAGGGAGG - Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131532293 15:93204356-93204378 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132029623 15:98429224-98429246 CTGGGTTTGAAGATGAAGGAAGG - Intergenic
1132192983 15:99885012-99885034 GTTGGCTTGAAGATGGAAGATGG - Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1202954746 15_KI270727v1_random:69252-69274 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1133349437 16:5091757-5091779 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133534846 16:6691905-6691927 CTGGTTTTGAATATGGAGGAAGG + Intronic
1133573783 16:7067983-7068005 CTGGCTTTAAAGATGAAGGAAGG - Intronic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134742229 16:16558121-16558143 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1134925335 16:18154335-18154357 CTGCCCTTGAAGATGGAGGAAGG - Intergenic
1135159585 16:20081985-20082007 CTGGGCTTTAGGAGGCAGGCAGG - Intergenic
1135177424 16:20242900-20242922 CTGGGAATTGGGATGGAGGATGG + Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1136019140 16:27428819-27428841 CTGGGCTTTGTGATGGAGTAAGG + Intronic
1136244693 16:28967711-28967733 CTCGGCTTTCACATGAAGGAGGG + Intergenic
1136247921 16:28985805-28985827 TGGGGCTGGAAGATGGAGGATGG - Intronic
1136271739 16:29152638-29152660 CTGGGCTTGTAGGTGGAGAAGGG - Intergenic
1136288645 16:29258713-29258735 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1137374415 16:47940536-47940558 CTGGGATGGAGGATGGAGGATGG - Intergenic
1137510020 16:49090973-49090995 GTGAGCATTCAGATGGAGGAAGG - Intergenic
1138639631 16:58374155-58374177 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1138845846 16:60564767-60564789 CTGGGAATAAATATGGAGGAGGG + Intergenic
1138888742 16:61114874-61114896 CTGGCCTTGAAGATGGAAGGAGG + Intergenic
1139309457 16:66016193-66016215 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1139374568 16:66488739-66488761 CTGGCTTTTAAGATGGAGGAAGG + Intronic
1139392451 16:66613402-66613424 CTGGGCTCTAGGAAGAAGGAGGG - Exonic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140619299 16:76708506-76708528 CTGACGTTGAAGATGGAGGAAGG + Intergenic
1140677068 16:77342939-77342961 CTGGCTTTGAAGATGAAGGAGGG + Intronic
1140700510 16:77577171-77577193 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140787062 16:78352480-78352502 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1140987644 16:80173905-80173927 CTGGGTTTAAGCATGGAGGAAGG + Intergenic
1141145888 16:81529738-81529760 CCCGGCTTTAAGATGGAGGAAGG + Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141191073 16:81824975-81824997 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141263348 16:82473717-82473739 CTGGCTTTCAAGATGGAGGAAGG - Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141329980 16:83102094-83102116 CTGGCTTTGAAGATGAAGGAAGG + Intronic
1141372695 16:83502318-83502340 CTGGCTTTGAAGATGGAGCAAGG + Intronic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1142075406 16:88114798-88114820 CTGGGCTTGTAGGTGGAGAAGGG - Intronic
1142094360 16:88231619-88231641 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142282539 16:89156200-89156222 CTGGGCTTTAATGGGGAGGGAGG - Intergenic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143197540 17:5087648-5087670 CTGGGCCTGAAGAGAGAGGAGGG + Intronic
1143262739 17:5612203-5612225 CTGGCCTTGAAGATAGAGGAAGG + Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1143476377 17:7205826-7205848 ATGGGCTATGGGATGGAGGACGG - Intronic
1144515519 17:15915193-15915215 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149063512 17:52453031-52453053 CTGGGCTTGAAGCTGCATGAGGG + Intergenic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149657690 17:58319026-58319048 CTGGGCTTTTGGATAGAGCAGGG - Intronic
1150504334 17:65682799-65682821 CTGGGCATTAACAGAGAGGAAGG - Intronic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1150919586 17:69469187-69469209 CAGGCTTTTAAGATGAAGGAAGG - Intronic
1150939801 17:69679770-69679792 CTTGGTTTTATGATGGAGAATGG + Intergenic
1151020915 17:70616519-70616541 CTGGCCTTTTAGATGTAAGAGGG - Intergenic
1151025488 17:70671749-70671771 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151279655 17:73063902-73063924 ATTGTATTTAAGATGGAGGAAGG - Intronic
1151307086 17:73269976-73269998 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
1151603692 17:75122978-75123000 CTGTAATTTAAGATGAAGGAGGG - Intronic
1151678887 17:75613831-75613853 CTGGGCTTGGAGAAGGAGGAGGG - Intergenic
1152172582 17:78762757-78762779 CTGGCTTTGAAGATGCAGGAAGG + Intronic
1152252374 17:79218745-79218767 CTGGCCTTGAAGAATGAGGAGGG + Intronic
1152395395 17:80029950-80029972 CTGGCCTTGAAGATGCAGGAAGG - Intronic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153552883 18:6280818-6280840 CTAGTTTTGAAGATGGAGGAAGG + Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153842420 18:9018735-9018757 TTGGTTTTGAAGATGGAGGAAGG + Intergenic
1153951090 18:10058334-10058356 CTGGTCATTAAGATGAAAGAGGG + Intergenic
1153955095 18:10089343-10089365 CTGGGCTTGATGAAGGAGTAAGG + Intergenic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154301852 18:13201141-13201163 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1154447520 18:14447706-14447728 CAGGGATTTCAAATGGAGGAAGG - Intergenic
1155193392 18:23451078-23451100 ATGGGCTGTAAGGTGGAGCAGGG - Intergenic
1155341028 18:24814299-24814321 CTGGCTTTGAAGGTGGAGGACGG - Intergenic
1155437024 18:25824192-25824214 CTGGCTTTGAAGATGGAGGCAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1155864713 18:30950898-30950920 CTGTCATTGAAGATGGAGGAAGG + Intergenic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156314197 18:35952027-35952049 TTGGTTTTGAAGATGGAGGAAGG - Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157245267 18:46048223-46048245 GGTGGCTTGAAGATGGAGGAAGG + Intronic
1157881900 18:51328721-51328743 CTGGCGTTGAGGATGGAGGAAGG - Intergenic
1158219320 18:55133893-55133915 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1159696200 18:71559506-71559528 GTTGGCTTGAAGATGGAGCAAGG - Intergenic
1159846567 18:73468087-73468109 CTTGGTTTGAAGCTGGAGGAAGG + Intergenic
1159863106 18:73672429-73672451 CTGAGATTCAAGGTGGAGGAGGG + Intergenic
1159891363 18:73956100-73956122 CTGGCATTGAAGATGGGGGAAGG - Intergenic
1159916745 18:74194747-74194769 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1160055922 18:75480471-75480493 CTGGGGTTGAAGATTGAGGGGGG - Intergenic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160335976 18:78039996-78040018 CTGGCCTTGAGGATGGAGGAGGG - Intergenic
1160508020 18:79438020-79438042 CTGGGCGTGAAGGTGGAGGCTGG + Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1162050701 19:8030846-8030868 CTGGCCGTGAAGGTGGAGGAAGG + Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1163049483 19:14671387-14671409 CTGGATTTAAAGAAGGAGGAAGG - Intronic
1163840003 19:19601708-19601730 CTGGCCTTGATCATGGAGGAAGG + Intronic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165602363 19:37065469-37065491 CTGGCTTTTGAGATGGAGGAAGG + Intronic
1166284066 19:41812776-41812798 CTCGCTTTGAAGATGGAGGAAGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166820539 19:45576694-45576716 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1167639753 19:50674335-50674357 CTGGTCTCAAAGATGGAGAAGGG - Intronic
1168280728 19:55304128-55304150 GTGGGATTTAAGAAGGAGAAAGG + Intronic
1202689504 1_KI270712v1_random:77020-77042 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
925481944 2:4285255-4285277 CTGGCTTTGAAGATGAAGGAGGG + Intergenic
925731761 2:6924159-6924181 CTTGGGTTTAAGAGTGAGGATGG + Intronic
926028263 2:9563604-9563626 CTGGGCCTTCAGAGGGAGCATGG + Intergenic
926128294 2:10285211-10285233 CAGGGGTTTATAATGGAGGAGGG + Intergenic
927183627 2:20466878-20466900 CTTGGCCTAAAGATGAAGGAGGG - Intergenic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927832099 2:26360649-26360671 CTGTGCTTTAAGATGGATGGTGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928081535 2:28316533-28316555 AAGGCCTTTAAGTTGGAGGAGGG - Intronic
928309343 2:30196747-30196769 CTGGCTTTGAAAATGGAGGAAGG + Intergenic
928600251 2:32897428-32897450 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
928686888 2:33759242-33759264 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
928807563 2:35178879-35178901 CTGGATTCTGAGATGGAGGAAGG - Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930593051 2:53353196-53353218 CTGAGGATTAAGATGGTGGATGG + Intergenic
930769251 2:55115326-55115348 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932106570 2:68948573-68948595 CTTGGGTTTGAGATGGAGAAGGG - Intronic
932222293 2:70009188-70009210 GTAGGCTTTAGGATGGGGGAAGG + Intergenic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932819437 2:74887009-74887031 CGGCGCTGGAAGATGGAGGAGGG - Intronic
932829475 2:74975113-74975135 CTGGCTTTGAAGATGGAGGGGGG + Intergenic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932872135 2:75412540-75412562 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
933161383 2:79027882-79027904 CCAGGGTTTAAGATGGTGGAGGG - Exonic
933244347 2:79958499-79958521 CTGGGCTTGAAGATGGAGGAAGG + Intronic
933449192 2:82424743-82424765 CTGGCTTTGAAGTTGGAGGAAGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933956930 2:87379072-87379094 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934061466 2:88298033-88298055 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
934241051 2:90270962-90270984 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
934272127 2:91545723-91545745 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
934728630 2:96641897-96641919 CTGTGCATTAAGATGGAGCTGGG - Intronic
934843984 2:97649969-97649991 GTGGCTTTGAAGATGGAGGAAGG + Intergenic
934926675 2:98386768-98386790 CTGGCTTTGAAGATGTAGGAAGG + Intronic
935109321 2:100077375-100077397 TTGGCTTTGAAGATGGAGGATGG + Intronic
935141539 2:100357554-100357576 CTGGCTTTGAAAATGGAGGAGGG - Intergenic
935232168 2:101108596-101108618 CTGGTCTTGGAGATGGAGCAAGG - Intronic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935420800 2:102866859-102866881 CCAGGCTTTGAGATGGAGGAAGG + Intergenic
935674442 2:105582062-105582084 CTGGCTTTGAAGATCGAGGAAGG + Intergenic
935679612 2:105624653-105624675 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
936148108 2:109995349-109995371 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
936196585 2:110376099-110376121 CTGGCTTTGAGGATGGAGGAAGG - Intergenic
937160304 2:119754853-119754875 CTAGGTTTGAAGATGGTGGAAGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937426793 2:121806648-121806670 CTGGCATTGAAGATGGAGGAAGG + Intergenic
937600088 2:123721177-123721199 GTGGCTTTGAAGATGGAGGAAGG - Intergenic
937963309 2:127480536-127480558 GTGGGCTTTAGGGTGGAGGCTGG - Intronic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
938324454 2:130389061-130389083 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
940214228 2:151288380-151288402 CTGGCCCTGAAGATGGAGGAAGG + Intronic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
940900981 2:159125968-159125990 CTGGCATTGAAGATGAAGGAAGG - Intronic
941063817 2:160878370-160878392 CTGAGCTTGAAGATGGAGGAAGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
943896370 2:193366984-193367006 CTAGCTTTTAAGAAGGAGGAAGG - Intergenic
943976529 2:194485479-194485501 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
944157478 2:196622457-196622479 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944763908 2:202844980-202845002 CTGGCCTTAAAGATGGAGGAAGG - Intronic
944997128 2:205306107-205306129 CTGGCTTTCAAGATGGAGGGAGG + Intronic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945755262 2:213837897-213837919 CTGGCTTTGAAGATGAAGGAAGG + Intronic
945918079 2:215725817-215725839 CTGGTTTTGAAGTTGGAGGAAGG - Intergenic
946965033 2:225028274-225028296 CTGGCTTTGAAGATGAAGGAAGG + Intronic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947538069 2:230953421-230953443 CTGGGTTTGAAGACGGAAGAAGG + Intronic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947950351 2:234141790-234141812 CTGGCTTTGAAGATGCAGGAAGG - Intergenic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948785552 2:240350609-240350631 CTGACGTTGAAGATGGAGGAGGG + Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1168901314 20:1367503-1367525 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1169206403 20:3742540-3742562 CTGGGGTAAAAGTTGGAGGATGG + Intronic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1171326734 20:24300910-24300932 CTGAGCTGGAAGAAGGAGGAGGG + Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172515222 20:35528580-35528602 CAGGGCTTTGAGATGGACGTGGG - Intronic
1172812836 20:37662042-37662064 CTGGCCTTGAAGATGGAGGAAGG - Intergenic
1172886630 20:38235552-38235574 CTGGCTTTGAGGATGGAGGAAGG + Intronic
1173071316 20:39769716-39769738 CTGGTCTTGAAGACAGAGGAAGG + Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173488017 20:43455917-43455939 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174062642 20:47843543-47843565 ATGTGCTTGAGGATGGAGGAAGG + Intergenic
1174072993 20:47911952-47911974 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1174095690 20:48087940-48087962 CAGGGCTGAGAGATGGAGGAGGG - Intergenic
1174096874 20:48096736-48096758 CTGGGCTGTAAGATGTAGCCTGG - Intergenic
1174151067 20:48486690-48486712 ATGTGCTTGAATATGGAGGAAGG + Intergenic
1174183312 20:48688602-48688624 CTGGGCTCTCAGCTGGAGGTGGG - Intronic
1174302987 20:49595614-49595636 CTGGCTTTGAAGATGGAGGTTGG - Intergenic
1174433538 20:50488983-50489005 CTGGCTTTAAAGATGAAGGATGG - Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175010954 20:55735519-55735541 CAGGTCTTAAAGATGGAGGAAGG - Intergenic
1175239026 20:57533172-57533194 GCTGGCTTTGAGATGGAGGAAGG + Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175334251 20:58184867-58184889 CTGGCCTGGAAGATGGAAGAAGG + Intergenic
1175473324 20:59249787-59249809 TTTTGGTTTAAGATGGAGGATGG + Intronic
1175495971 20:59414503-59414525 CTGGCTTGGAAGATGGAGGATGG - Intergenic
1175523236 20:59616384-59616406 TTGGGCCTCAAGATGCAGGAGGG + Intronic
1175692134 20:61073178-61073200 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1175938432 20:62525927-62525949 CTGGCCTTCAAGATGGAGGCGGG - Intergenic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1177065309 21:16425931-16425953 ACGGGCTTTAAGATGGAAAATGG - Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1177914273 21:27068879-27068901 CTGGCTTTAAAAATGGAGGAAGG + Intergenic
1178182564 21:30179638-30179660 GTGGCTTTCAAGATGGAGGACGG + Intergenic
1178258114 21:31073962-31073984 CTGGCTTTGAAGATGGAGGGAGG - Intergenic
1178362878 21:31964460-31964482 GTGGGGTTTGCGATGGAGGAAGG + Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179008542 21:37535060-37535082 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1179147252 21:38778929-38778951 CTGGCATTGAAGATGGAGGATGG + Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179240090 21:39582197-39582219 CTGGCTTTGAAGATGCAGGAGGG + Intronic
1179533887 21:42038989-42039011 CTGGCCTTGAAGATGGAGGAGGG + Intergenic
1180849679 22:19009774-19009796 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
1181150818 22:20882040-20882062 CTGGCCTTGAAGATAGAGAAAGG + Intronic
1181352112 22:22266482-22266504 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1181664912 22:24387930-24387952 TTGGCTTTGAAGATGGAGGAAGG - Intronic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182053508 22:27331408-27331430 CTGGTCATCAAGATGGAGCAGGG + Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1182883414 22:33753348-33753370 CTGGCCTTGGGGATGGAGGAAGG + Intronic
1183040014 22:35170947-35170969 CTGGCCTTGTAGATGGAGGGAGG + Intergenic
1183244979 22:36686473-36686495 CTGGCATGTAAGAGGGAGGAAGG + Intronic
1183409131 22:37644771-37644793 TGGGGCTCTAAGATGGTGGAGGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184804185 22:46781818-46781840 CGGGGCTCTCAGATGGAAGAGGG - Intronic
1184923606 22:47622749-47622771 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949202482 3:1395470-1395492 CTGGCATTGAACATGGAGGAAGG - Intronic
949204141 3:1417686-1417708 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
949700721 3:6754064-6754086 CTGGGCTTTATGATGGAGAGAGG - Intergenic
950073377 3:10170168-10170190 ATGGCCTTGATGATGGAGGAAGG - Intronic
950114828 3:10444095-10444117 CTGGGCCTTAGAATGGAGCATGG + Intronic
950221002 3:11196105-11196127 AGGAGCTTTAAGAGGGAGGAGGG - Intronic
950796214 3:15512417-15512439 CTGGGCTGGGAGATGGAAGAGGG + Intronic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
951313296 3:21157312-21157334 CTGACATTGAAGATGGAGGAAGG - Intergenic
951391872 3:22114908-22114930 CTGTGCTTTCACATGGTGGAAGG - Intronic
951677886 3:25262578-25262600 CTGGACTTGAAGATGAAGGAAGG - Intronic
952034771 3:29186971-29186993 CTGGCCTTGAAGATGAAGAAGGG - Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952721664 3:36540121-36540143 CTGGCCTTGAAGGTGAAGGAAGG + Intronic
953373695 3:42410994-42411016 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953389637 3:42526847-42526869 CTGGCCTTTCCGGTGGAGGAGGG - Intronic
953857519 3:46511441-46511463 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954661262 3:52228127-52228149 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955567874 3:60268950-60268972 CTGGCTTTAAAGATAGAGGAAGG + Intronic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956319135 3:67975939-67975961 CTGGCCTTTAAGGTGGAGGAAGG - Intergenic
956715559 3:72076733-72076755 CTGGCCTTGAAGCTGGAAGAAGG - Intergenic
956736721 3:72244140-72244162 CTGGCCTTGAAAGTGGAGGAAGG - Intergenic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957053745 3:75429099-75429121 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
957128996 3:76199252-76199274 CTGGCTTTGAAGATGTAGGAAGG + Intronic
957142479 3:76379044-76379066 CTGTGCTTAATGATGGAGGGTGG + Intronic
959190517 3:103104582-103104604 CTGGGTTTAAAGATGGAAGGAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959412385 3:106040812-106040834 CTGGCTTTAAAGATAGAGGAAGG - Intergenic
959747231 3:109790931-109790953 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
959787847 3:110321961-110321983 CTGGGTTTTAAAATTGAGGAGGG - Intergenic
959848708 3:111063420-111063442 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
961301100 3:125922580-125922602 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
961506020 3:127371033-127371055 CTGGCCTTTTAGCTGGAGGTGGG - Intergenic
961584900 3:127914449-127914471 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961887425 3:130105493-130105515 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
961990172 3:131181269-131181291 CTAGCTTTGAAGATGGAGGAAGG + Intronic
962088090 3:132212975-132212997 CGGGCTTTAAAGATGGAGGAAGG + Intronic
962365322 3:134775254-134775276 CAGGGCTGTAAGATGGGGCAGGG + Intronic
962522351 3:136209074-136209096 CTGAGCTTTGAGAGGGAGCATGG + Intergenic
963006797 3:140734035-140734057 CTGGCTTTGAAGTTGGAGGAAGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963419883 3:145048231-145048253 CTGGGTTTTAAGGAGCAGGATGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
963840241 3:150097443-150097465 CTGGGCTTTGTGAGGGTGGAGGG - Intergenic
964219747 3:154329601-154329623 CTGGCCTTGAAGATGGAGGAAGG + Intergenic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964897068 3:161611612-161611634 CTGGCTTTCAATATGGAGGAAGG - Intergenic
965186155 3:165467040-165467062 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
965246693 3:166280673-166280695 CTGGTTTTGAAGATGAAGGAAGG - Intergenic
965421129 3:168459869-168459891 CTGGACTTTAAGAATTAGGATGG - Intergenic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
965620562 3:170638699-170638721 CTGGGGTGGGAGATGGAGGATGG - Intronic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
965856335 3:173092556-173092578 CTGGCTTTGAAGACGGAGGAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966666127 3:182472929-182472951 CTGGTTTTGAGGATGGAGGAAGG - Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
967085634 3:186092740-186092762 CTGGGTTTTAAAATAGATGACGG + Intronic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967818277 3:193817036-193817058 CTAGGCTCTCAGCTGGAGGATGG - Intergenic
968976078 4:3822692-3822714 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
968996549 4:3949411-3949433 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969224634 4:5787468-5787490 CTGGACTTGAAGACGGAGGAAGG + Intronic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969594617 4:8142041-8142063 CTGGGCTTGCAGCTGGAGGGAGG - Intronic
969757451 4:9159271-9159293 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969817411 4:9696807-9696829 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969833333 4:9817022-9817044 CTGGCCTTGAAGACGGAGGAAGG - Intronic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970527934 4:16951248-16951270 CTGGCTTTGAAGATGCAGGAAGG + Intergenic
970554560 4:17218122-17218144 CTGGCTTTAAAGATGAAGGATGG - Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
970656803 4:18240227-18240249 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
970713656 4:18894544-18894566 ATGCACTTTAAGATGGAGAAAGG + Intergenic
970764415 4:19530440-19530462 CTGGCTTTCAAGGTGGAGGAAGG - Intergenic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971118198 4:23673055-23673077 CTGATGTTGAAGATGGAGGAAGG + Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971539365 4:27796385-27796407 CCAGGCACTAAGATGGAGGAAGG - Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971702290 4:29994088-29994110 CTGGCTTTTAAAGTGGAGGAAGG - Intergenic
971878972 4:32342908-32342930 CTGGCTTTGAAGCTGGAGGAAGG + Intergenic
972002138 4:34050932-34050954 GTGGGCTTTAAGTTCCAGGAAGG + Intergenic
972247915 4:37265593-37265615 CTGGCACTGAAGATGGAGGAAGG - Intronic
972464576 4:39342861-39342883 CTGGCTTTGAAGATGCAGGAAGG - Intronic
972605959 4:40614199-40614221 CTTGGCTTTAAGTCGCAGGAAGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
973229485 4:47825193-47825215 CTGGGCTTGTTGCTGGAGGAGGG + Intronic
973329450 4:48897400-48897422 TTGGCCTTGAAGATGGAGGAAGG - Intronic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974018718 4:56674140-56674162 CTGGGATTTATGAAGCAGGAGGG - Intronic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
974451122 4:62061613-62061635 CAGGGGTGAAAGATGGAGGATGG - Intronic
975062533 4:70020172-70020194 CTGGCTTTGAACATGGAGGAAGG - Intergenic
975524979 4:75339181-75339203 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
975935362 4:79573105-79573127 CTGGGCCATAGAATGGAGGATGG - Intergenic
976069509 4:81224978-81225000 TTGGCTTTGAAGATGGAGGAAGG - Intergenic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976962571 4:90997252-90997274 CTGGCTTTGAAGATGAAGGATGG - Intronic
976997544 4:91454348-91454370 CTGGCTTTAAAGATGGGGGAAGG - Intronic
977156203 4:93577174-93577196 CTGGGCTTTAAGATATTTGAGGG - Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
977938239 4:102829396-102829418 CTAGGCATGAAGATGGAGGGAGG + Intronic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
979026172 4:115579152-115579174 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
980022845 4:127730238-127730260 CTGGGCTTTCTGATGAGGGAGGG - Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980100911 4:128540359-128540381 CTGGCTTTAAAGATGCAGGAAGG - Intergenic
980102032 4:128551484-128551506 CTGGCTTTGAAGATGAAGGAGGG - Intergenic
980402089 4:132303851-132303873 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
980851743 4:138390594-138390616 CTGGTTTTGAAGCTGGAGGAAGG + Intergenic
981701365 4:147610533-147610555 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
984345887 4:178524537-178524559 CTAGCCTTTAGGATGGAGAAAGG + Intergenic
984413806 4:179431641-179431663 CTGGACTGTAAGATGGAGGTGGG + Intergenic
984459150 4:180010904-180010926 CTGGCTTTTAATATGGAAGATGG - Intergenic
985478992 5:95559-95581 CTGGGCTTTACCAGAGAGGAAGG - Intergenic
985679866 5:1250254-1250276 GCTGGCTTTGAGATGGAGGAGGG - Intergenic
986022640 5:3819364-3819386 GTGGGCTTTAGGATGATGGATGG + Intergenic
986664646 5:10090193-10090215 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
986704479 5:10443820-10443842 CTGGCCTTGAAAATGGAGGAAGG - Intronic
986939519 5:12934450-12934472 TTGGCCTTGAAGATGGAGGAAGG + Intergenic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
988445545 5:31282344-31282366 CTGGGCTTGAAGACGGAGGAAGG - Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990601353 5:57361610-57361632 CTTCGCTTTCAGATGGAGAAAGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990662863 5:58037927-58037949 CTGGCCTTGAAGATGGAAGAAGG + Intergenic
990998064 5:61753308-61753330 CTGAGCTGAAAAATGGAGGATGG + Intergenic
991025182 5:62021521-62021543 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
991473617 5:66996680-66996702 CTGGGCCTGAAGATGGAGGAAGG - Intronic
991587285 5:68214680-68214702 CAGGGCTTTAAGCTGCAGAAAGG + Intergenic
992415444 5:76548353-76548375 CTGTGCTTTAAGACAGATGAAGG - Intronic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994737138 5:103569264-103569286 CTGGGCTTTAAGAAGTGGGTAGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995437788 5:112157590-112157612 CTGGCTTTGAAGATGTAGGAAGG - Intronic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
995936244 5:117519072-117519094 CTAGCTTTAAAGATGGAGGAAGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996362972 5:122670867-122670889 CTGGCCTTTCAGAGGGTGGAAGG - Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996479550 5:123959303-123959325 CTTGCCTTTAAGATGGAGGAAGG - Intergenic
996624755 5:125557312-125557334 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
997205439 5:132045964-132045986 CTGGGCTTAAAGATGGAGGGAGG - Intergenic
997255826 5:132427257-132427279 CAGGTCTTTTAGAGGGAGGAAGG + Intronic
997261547 5:132469231-132469253 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
998098649 5:139413401-139413423 CTGGGTTCTATGATGGAGTAGGG + Exonic
998357446 5:141552456-141552478 CTGGCTTTAAAGATTGAGGAAGG + Intronic
998511692 5:142719058-142719080 ATGGGCTCCCAGATGGAGGAGGG + Intergenic
998690561 5:144583066-144583088 ATGGGCTTAAAAATGGATGATGG - Intergenic
998861404 5:146447536-146447558 ATGGGGTTTAAGAAGGGGGAAGG + Intronic
999531751 5:152470671-152470693 CTTTGGTTAAAGATGGAGGAAGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1000397482 5:160790983-160791005 GTTGGTTTGAAGATGGAGGAAGG + Intronic
1000971645 5:167721550-167721572 CTGGCTTTGAAGATGAAGGAAGG - Intronic
1001052065 5:168421603-168421625 ATGAGCTGAAAGATGGAGGAAGG + Intronic
1001129563 5:169052736-169052758 CTGGGTTTTAAGTGGTAGGAAGG + Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001244186 5:170093528-170093550 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1001834630 5:174821425-174821447 CTGGCTTTGAAGATGAAGGAAGG + Intergenic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1003408345 6:5841253-5841275 TCAGGCTGTAAGATGGAGGAGGG + Intergenic
1003850521 6:10217889-10217911 GTGTGCTTTAAGATGGAATAAGG + Intergenic
1003981254 6:11392304-11392326 CTGGCTTTCAAGATAGAGGAAGG - Intergenic
1004364407 6:14999703-14999725 CTGTTCTTTGAAATGGAGGAAGG - Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005204312 6:23383232-23383254 CTTGGCTTGAAGACAGAGGAAGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006773250 6:36571523-36571545 CTGACTTTTAAGATGGAGGAAGG - Intergenic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007393627 6:41564779-41564801 GAGGGCTTTAAAATGGAAGATGG + Intronic
1007413822 6:41680389-41680411 ATGGGCTTTGAGATGGAGCACGG + Intergenic
1007545584 6:42691383-42691405 TTGGGTTTTAAGATCGAGCAAGG + Exonic
1007548139 6:42709532-42709554 CTAGGCCATAAGATCGAGGAAGG - Intronic
1007825352 6:44595750-44595772 CTGGACTGCAAGATGGAGAAAGG + Intergenic
1007934529 6:45721295-45721317 CTGGCCTTGAAAATGGAGAAAGG + Intergenic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008179695 6:48313066-48313088 CTGGCCTGTAAGATGGAAGAAGG + Intergenic
1008957913 6:57235859-57235881 CTGGCTTTCAAGATGGAGAAGGG + Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012586433 6:100928594-100928616 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1012833828 6:104240178-104240200 CTGGCTTTGAAGATAGAGGAAGG - Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1013420295 6:109960981-109961003 CTGGTCTTGAAGATGGAGAGAGG + Intergenic
1013526249 6:110976533-110976555 CTGGCTTTGAATATGGAGGAAGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015688346 6:135891857-135891879 CTGGACTGTAAGCTTGAGGAAGG + Intronic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1015966727 6:138701735-138701757 TTCTGCTTTAGGATGGAGGAAGG - Intergenic
1016016855 6:139195149-139195171 CTGGCATTCAAGATGGGGGAAGG - Intergenic
1016250087 6:142030438-142030460 CTTGGCTTTAAGACAGAAGAAGG - Intergenic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018395773 6:163377113-163377135 CTGGGCTTCAGGCTGCAGGAAGG - Intergenic
1018657315 6:166050710-166050732 CTAGTCTTGAAGATGGAGAAAGG + Intergenic
1019520126 7:1457062-1457084 CTGGGCTGGAAGAGGCAGGAAGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019739827 7:2667112-2667134 CTGGCTTTGAAGGTGGAGGAAGG - Intergenic
1020146798 7:5650647-5650669 CTGGCTTTGAAGATGGATGAAGG - Intronic
1020218840 7:6218329-6218351 CTGGGTTTGAAGATGGAGAGAGG + Intronic
1020320830 7:6937826-6937848 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1020772556 7:12413392-12413414 CTGGTTTTAAAGATGAAGGAAGG - Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1022832957 7:34086659-34086681 CAGGGCTTGAGGATGGAGGGAGG + Intronic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023167623 7:37358461-37358483 CTGGGCAATAAGATGCAAGATGG - Intronic
1023304958 7:38816243-38816265 ATGGGCTGTGAGATGGGGGAAGG + Intronic
1023803250 7:43852949-43852971 CTGGCATTGAAGATGGAGTAAGG - Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024287654 7:47773158-47773180 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1025228676 7:57184266-57184288 CTGGTCTTGAAGACGGAAGAAGG + Intergenic
1025231806 7:57207599-57207621 ATGTGCTTGAGGATGGAGGAAGG - Intergenic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026044120 7:66893983-66894005 CTGGCCTTCAAGATGGAGTCAGG + Intergenic
1026057947 7:67001355-67001377 CGCAGCTTTAAGATGGAAGATGG - Intronic
1026343973 7:69458001-69458023 CTGGGCTGGAAGTTGGGGGAAGG + Intergenic
1026644485 7:72155893-72155915 CTGGCATTGAAGGTGGAGGAGGG - Intronic
1026720151 7:72823683-72823705 CGCAGCTTTAAGATGGAAGATGG + Intronic
1027203863 7:76081497-76081519 CTGGCTTTGAAGATGGAGTAAGG - Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1028843658 7:95455383-95455405 CTGGCTTTGAAGATGGACGAAGG - Intergenic
1028925206 7:96350082-96350104 CTGGGCTTAAAGATAGAAGAAGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029544604 7:101203568-101203590 CTGGGCTGGAAGATGGGGCAGGG + Intergenic
1029906823 7:104101046-104101068 CTGGGTTTGTAGATGAAGGAAGG + Intergenic
1030177567 7:106670737-106670759 CTAGCTTTCAAGATGGAGGAAGG - Intergenic
1030284450 7:107811428-107811450 CTGGTGTTGAAGATGCAGGAAGG - Intergenic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1031132072 7:117844116-117844138 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1031583770 7:123508162-123508184 CTGGCTTTTAAAACGGAGGAAGG + Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031876149 7:127143087-127143109 CTGGTCTTTAAGATTAAGCATGG + Intronic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1033594119 7:142842430-142842452 ATGGGCTCTGAGATAGAGGAAGG - Intergenic
1033619296 7:143048131-143048153 CTGGCTTTGAAGATGGACGAGGG + Intergenic
1033858922 7:145600369-145600391 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1034381630 7:150700955-150700977 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1034538965 7:151744048-151744070 ATGGGCTCGAAGATGGAGCACGG + Intronic
1035108057 7:156458428-156458450 CTGGGCTTTAAGGAGGCAGATGG + Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036380694 8:8234599-8234621 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036848880 8:12188035-12188057 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036870241 8:12430313-12430335 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1037226902 8:16603223-16603245 CTGGGTTTGATGATGGAGAAAGG + Intergenic
1037392337 8:18406581-18406603 GAGTTCTTTAAGATGGAGGAAGG + Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1037890899 8:22623253-22623275 AAAGGCTTGAAGATGGAGGAGGG + Intronic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038049122 8:23792546-23792568 GCTGGGTTTAAGATGGAGGAAGG - Intergenic
1038105247 8:24426344-24426366 CTCATCTTTAAAATGGAGGATGG - Intergenic
1038127024 8:24685894-24685916 CTGGCTTTAAAGATGGAGGGAGG - Intergenic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1039077429 8:33704423-33704445 CTGGCTTTGAAGATGGAGGGAGG + Intergenic
1039459031 8:37727787-37727809 CTTGGGTTTAAGATGATGGAAGG + Intergenic
1039970403 8:42317032-42317054 CTGGTTTTTAAGTTGGAGTATGG + Intronic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041492404 8:58449029-58449051 CTGGTTTTTAAGATGGAAGAAGG - Exonic
1041800537 8:61793007-61793029 CTGGAATTTGAGATGGAGAAAGG + Intergenic
1041991002 8:63991627-63991649 CTTACTTTTAAGATGGAGGAGGG - Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042480638 8:69298236-69298258 CTGGCTTTTAAGAGGGAGGAAGG - Intergenic
1042638925 8:70910935-70910957 CTGGACTTGAAGATGGGTGAAGG - Intergenic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1044000105 8:86868989-86869011 CTGGCTTTGAAGATGGAGGGGGG + Intronic
1044341765 8:91054259-91054281 TTGGCTTTGAAGATGGAGGAGGG - Intergenic
1044398657 8:91743996-91744018 TTGGCTTTGAAGATGGAGGAAGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046019612 8:108648669-108648691 CTGGCTTTCAAGATGGAGGGAGG + Intronic
1046124298 8:109884885-109884907 CTGGTGTTAAAGATGGAGGAAGG - Intergenic
1046489799 8:114936658-114936680 CTGCCCTTGAAGATGGAGCAAGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1046960718 8:120110238-120110260 CTGCCCTTTTAGATGGAGGGGGG - Intronic
1047748910 8:127865553-127865575 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1048489628 8:134880609-134880631 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048894143 8:138974168-138974190 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1049976321 9:863443-863465 CTGGCTTTGAAGGTGGAGGAAGG + Intronic
1050127893 9:2378442-2378464 CTGGCTTTAAAGATGGAGAAAGG + Intergenic
1050392762 9:5163604-5163626 CTGTGTTTTAAGATGGATTATGG - Intronic
1050876056 9:10638041-10638063 CTGGCTTTTATGATGGAGTAAGG + Intergenic
1051086919 9:13360460-13360482 CCTGGCTTAAAGATAGAGGAAGG + Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1052016930 9:23479612-23479634 ATGGCTTTGAAGATGGAGGAAGG - Intergenic
1052736231 9:32345252-32345274 ATGGGGTTTGAGAAGGAGGAGGG - Intergenic
1053135138 9:35646259-35646281 CTAGGCTTTAAGAAAGAGGAGGG + Intronic
1053293590 9:36898090-36898112 CTGGGTTTGGAAATGGAGGATGG + Intronic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053404204 9:37857100-37857122 CTGGCCTATAAGACTGAGGAAGG - Intronic
1053420860 9:37976909-37976931 CTGGGCTTTATGATTCAGGCCGG + Intronic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055567964 9:77587981-77588003 CTGGCTTTGAAGATAGAGGAAGG - Intronic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1055981005 9:82000549-82000571 CTCGTCTTGAAGATGGAGGTAGG + Intergenic
1056118143 9:83461247-83461269 CTGGCTTTGAAGATGGAGGCAGG + Intronic
1056479060 9:86982506-86982528 CTGGCCTTGAAGATCGAGAAAGG + Intergenic
1056485530 9:87053322-87053344 CTGGCTTTGAAGATGAAGGAAGG - Intergenic
1056741357 9:89258064-89258086 CTGGCTTTGAGGATGGAGGAAGG + Intergenic
1057436176 9:95042668-95042690 CTAGCTTTAAAGATGGAGGAAGG - Intronic
1057519728 9:95751610-95751632 CTGAGCTGCAAGAGGGAGGATGG + Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1057771860 9:97975216-97975238 CTGGCCTCGAAGGTGGAGGAAGG - Intergenic
1057858770 9:98623636-98623658 CTGGCTTTGAAAATGGAGGAAGG - Intronic
1057926389 9:99154649-99154671 CTGGTTTTGATGATGGAGGAGGG - Intergenic
1058116564 9:101091477-101091499 CTGGGTTTGAAGATGAAGGAAGG - Intronic
1058547867 9:106080432-106080454 CTGGGATGAAAGATGGAAGAGGG + Intergenic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1058978851 9:110150439-110150461 CTGGCCTTGAAGATGGAGGAAGG - Intronic
1058979373 9:110155183-110155205 CTGGGATGTAAGATGAAGAAAGG + Intronic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059466120 9:114469909-114469931 CCAGCCTTGAAGATGGAGGATGG - Intronic
1059949866 9:119451090-119451112 CTGGTTTTAAAGGTGGAGGAAGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060144862 9:121243209-121243231 CTGGCCTTGAAGATGAAGGAAGG - Intronic
1061020031 9:128008377-128008399 CTGGCTTTGAAGGTGGAGGAAGG + Intergenic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061819825 9:133220910-133220932 CTGGCTTTGAAGGTGGAGGAGGG + Intergenic
1061916051 9:133754828-133754850 CTGGCTTTGAAGATGGAGCATGG + Intergenic
1062205791 9:135336198-135336220 CTGGGCTTGAGGGTGGAGCAGGG - Intergenic
1062240830 9:135537038-135537060 CTGGCTTTGAAGGTGGAGGAGGG - Intergenic
1062249188 9:135585839-135585861 CTGGGAGGGAAGATGGAGGAGGG - Intergenic
1062528269 9:136987330-136987352 CTGGGCTTCTAGGTGGAGAAAGG - Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186149649 X:6660788-6660810 CTGGGATATAAGATGGTGGAAGG - Intergenic
1186162402 X:6791607-6791629 GTGGGCTTTAAAGTGGAGGAAGG + Intergenic
1186206772 X:7208920-7208942 CCAGCCTTGAAGATGGAGGAAGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186424785 X:9455411-9455433 GCTGGCTTGAAGATGGAGGAAGG + Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186557416 X:10574279-10574301 CTGGCCTTGAAGATGGAGGAAGG + Intronic
1186577142 X:10778695-10778717 TTGGTCTTGAAAATGGAGGAAGG + Intronic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624509 X:11278404-11278426 CTGGCCTTGAAGCTGGAGGAAGG + Intronic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186656569 X:11618095-11618117 CTGGCTTTGAAAATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186755749 X:12669743-12669765 CTGGTTTTGAAGATGAAGGAAGG + Intronic
1186972675 X:14865113-14865135 CTAGGCTATGAGATGAAGGATGG - Exonic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187492556 X:19765435-19765457 CTGGCCTCGAAGATGGAGGAAGG - Intronic
1187504077 X:19864540-19864562 GTGGCTTTGAAGATGGAGGAAGG + Intronic
1187531465 X:20100670-20100692 CTGGCCTTGAAGACGGAGGAAGG + Intronic
1188061583 X:25607188-25607210 CTGGGCCTGAAGAGGGAGGCAGG - Intergenic
1188095126 X:26011891-26011913 CTGGAGTTGAAAATGGAGGAAGG - Intergenic
1188281267 X:28272579-28272601 CTGGCCTTGAAGATAGGGGAAGG + Intergenic
1188299224 X:28487058-28487080 CTGGCTTTGAAGATGGATGAAGG - Intergenic
1188510818 X:30934583-30934605 CTGGCTTTGAAGCTGGAGGAAGG - Intronic
1188584917 X:31762213-31762235 CTGTACTTTAAAATGGAAGAAGG - Intronic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189058200 X:37722754-37722776 TCTGGCTGTAAGATGGAGGATGG - Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189341735 X:40209734-40209756 CTGGGCTTTAAGGTGGAGGATGG - Intergenic
1189722298 X:43932863-43932885 CTAGCTTTGAAGATGGAGGAAGG - Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1190118603 X:47642016-47642038 TTGGCTTTGAAGATGGAGGAAGG + Intronic
1190576380 X:51843462-51843484 ATGGCTTTGAAGATGGAGGAAGG + Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191801942 X:65091243-65091265 ATGGCTTTGAAGATGGAGGAAGG + Intergenic
1192341357 X:70266242-70266264 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1192498857 X:71635442-71635464 CCAGGTTTTAAGATGGGGGAAGG - Intergenic
1192560473 X:72124808-72124830 CTGGGCTGAGCGATGGAGGAAGG - Intergenic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1193983745 X:88215267-88215289 CTGGTTTTGAAGATGTAGGAAGG - Intergenic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194354984 X:92871793-92871815 CTAGCCTTGAAGATGGATGAAGG - Intergenic
1195158510 X:102147400-102147422 CTGGCTTTTAAGATGAATGAAGG - Intergenic
1195270684 X:103226723-103226745 CTAGGCTTGAAGATGGAGGGAGG - Intergenic
1195376752 X:104235073-104235095 CTAGCTTTGAAGATGGAGGAGGG - Intergenic
1195721436 X:107872661-107872683 CTGGGCTTATAGAGGGAGAAAGG + Intronic
1196302914 X:114066946-114066968 CTGGCGTTGAAGAGGGAGGAAGG + Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197333487 X:125182179-125182201 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1197610896 X:128637063-128637085 CTGGCTTTGAAAATGGAGGAAGG - Intergenic
1198377341 X:136052871-136052893 CTGGCTTTGAAGATAGAGGAAGG + Intergenic
1198431219 X:136568049-136568071 CTGGCTTTGAAGATGGAGGCCGG - Intergenic
1198952455 X:142087131-142087153 TTGGCGTTGAAGATGGAGGAGGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199666016 X:150097130-150097152 CTTGCCTTGAAGATGGAGGAAGG - Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199735321 X:150680672-150680694 CTGGCTTTGAAGATGGAGCAAGG + Intergenic
1199744794 X:150765693-150765715 CTGGGTTTTAACATGGAGGTCGG - Intergenic
1199759045 X:150891403-150891425 CTGGCTTTGAAGATGGAGCAAGG - Intronic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1200229988 X:154439050-154439072 CTGGACTTCAAGGTGGTGGAGGG + Exonic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1200663341 Y:5988808-5988830 CTAGCCTTGAAGATGGATGAAGG - Intergenic
1200790053 Y:7291667-7291689 CTGGGCTGCAAGAGGGAGGGTGG - Intergenic