ID: 1088073143

View in Genome Browser
Species Human (GRCh38)
Location 11:105814134-105814156
Sequence GAATCAAGGCCTTTAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088073143 Original CRISPR GAATCAAGGCCTTTAGCACA TGG Intronic
900862103 1:5241150-5241172 GAATCAAGGCCCATGGCCCAGGG - Intergenic
905805070 1:40870504-40870526 GAATTAAGGCCTTTTGCTAATGG + Intergenic
910457792 1:87416171-87416193 GAAACAAGGCCTAAAGCTCAGGG - Intergenic
915095801 1:153461259-153461281 GACCCAAGACCTATAGCACAGGG - Intergenic
915869876 1:159547391-159547413 CATTCAAAGCCCTTAGCACAAGG + Intergenic
917051384 1:170928492-170928514 TCATTAAGGCCCTTAGCACAGGG + Intergenic
917739837 1:177951751-177951773 GCATCAAAGCACTTAGCACAGGG + Intronic
917973296 1:180222303-180222325 GGAATAAAGCCTTTAGCACAAGG - Intergenic
918296753 1:183164477-183164499 GAATCAAGGCCTCTACCACTGGG + Intergenic
920078765 1:203356715-203356737 GAATAAAGGCTTCTAGCAGAGGG + Intergenic
920544124 1:206801407-206801429 GACTCAAGGCCATTGGCACCTGG + Intronic
921029660 1:211326526-211326548 CAAGCAAGGCCTTGAGCAAATGG + Intergenic
1063063443 10:2582686-2582708 GTAAACAGGCCTTTAGCACAAGG + Intergenic
1063193467 10:3718940-3718962 GCATCCATGCCTTTAGCTCATGG - Intergenic
1068361253 10:55976935-55976957 AAATAAAGGCCTTTCCCACAGGG + Intergenic
1072121029 10:92405703-92405725 GAATCAAAGCCCTTGGCATAAGG + Intergenic
1074146037 10:110717940-110717962 GAAACAATCCCTTTTGCACATGG + Intronic
1082067346 11:47911414-47911436 GAATCAAAGCCTGTGGCAGAGGG - Intergenic
1083163982 11:60872403-60872425 GACACAAGGCCTTCAGAACAGGG + Intronic
1084435637 11:69137719-69137741 GAATGAAGGCCTTTGGAGCATGG + Intergenic
1085390284 11:76178786-76178808 GCAGGAAGGCCTTCAGCACAGGG + Intergenic
1088073143 11:105814134-105814156 GAATCAAGGCCTTTAGCACATGG + Intronic
1090154567 11:124424152-124424174 GATCCAAAGCCTTTAGCACATGG - Exonic
1090806963 11:130208824-130208846 GAATGGAGGCCTTTAGTAAAAGG + Intronic
1102538937 12:113604220-113604242 CACTCAAGGCCTTTAGCAAAGGG - Intergenic
1104791647 12:131486115-131486137 CATCTAAGGCCTTTAGCACAAGG + Intergenic
1106393218 13:29355908-29355930 GAATAGAGGCCTTCAACACAGGG - Intronic
1106796989 13:33216946-33216968 GAATCAAGGCCTTTAGTTTTGGG + Intronic
1108213143 13:48158432-48158454 CAACCAAGGCCTTCAGGACAAGG + Intergenic
1111386772 13:87538218-87538240 GACCCAAAGCCTTTTGCACAAGG + Intergenic
1111706461 13:91755475-91755497 TAATGAAGGCCTTTAGGACTTGG + Intronic
1112379895 13:98878875-98878897 GAATCTAGGCCTCCTGCACAAGG - Intronic
1113039544 13:106089840-106089862 GAATTAAGGCATGAAGCACATGG + Intergenic
1113658112 13:112082811-112082833 GTACCAAGGCCTTTAGAATATGG - Intergenic
1116025234 14:39506721-39506743 GAATCAAGTCCTTTCTCACCCGG - Intergenic
1118680914 14:68240697-68240719 GACTCAAGGACATTAGCCCAAGG + Intronic
1119650580 14:76380191-76380213 GAAACAAGGCATTCAGCAGAGGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1126305390 15:47249724-47249746 GAATAAAGGTCCTTAGCAAAAGG + Intronic
1127118603 15:55751471-55751493 AAATCAAGGCCTCCAGGACAAGG - Intergenic
1128418923 15:67473226-67473248 GAAGCATGGGCTTTTGCACATGG - Intronic
1134799799 16:17073132-17073154 TAATCAAGGCCTGTTGCCCAAGG - Intergenic
1135139726 16:19911264-19911286 CAATCAAGGCATTTAGCTAATGG + Intergenic
1143724650 17:8836870-8836892 GAATCTATGCCTTTTGCACAAGG - Exonic
1146404220 17:32523271-32523293 GAAGAAAGGTATTTAGCACAGGG + Intronic
1150284903 17:63949112-63949134 GGAGCAAGGCCTTCAGGACATGG - Intronic
1151093451 17:71469075-71469097 GAAGCATGGCCTTTGGTACAAGG - Intergenic
1151439596 17:74119592-74119614 GCATGAAGGCGTCTAGCACAAGG + Intergenic
1152618528 17:81349104-81349126 GAATCAAGGCCATTGTCAAACGG + Intergenic
1153692615 18:7608645-7608667 AAATCAGTGCCTTTAGCTCAAGG - Intronic
1156107370 18:33680448-33680470 GAACCAAAGACTTTAACACAGGG - Intronic
1164117185 19:22234026-22234048 GAATCATGGGCTTTAGCCAATGG - Intergenic
1168591022 19:57634200-57634222 GACTCAGGGCCCTTAGCTCAGGG - Intronic
925538093 2:4937779-4937801 GGATCCAGGCCTGTTGCACAGGG - Intergenic
925591293 2:5512551-5512573 GAATCCAGGCTTGCAGCACATGG - Intergenic
927134525 2:20087049-20087071 GAATAGAGGCCTTTCCCACAGGG + Intergenic
930847142 2:55918366-55918388 ATATCTAGGACTTTAGCACAAGG - Intronic
933372603 2:81435370-81435392 GAATCATGGCCTTGACCAAATGG + Intergenic
935951354 2:108332121-108332143 CATTCATGACCTTTAGCACAAGG + Intergenic
938753093 2:134353981-134354003 GACTCCAGGCCTTTGTCACATGG - Intronic
939460379 2:142490768-142490790 GAATAGAGGCCTTTCCCACAGGG - Intergenic
942379411 2:175372874-175372896 GACTTAAGGCCTGCAGCACATGG - Intergenic
944620318 2:201507834-201507856 GAAGCAAGGCCTTCTTCACATGG + Intronic
946288233 2:218721760-218721782 GAATGAAAGCTTTGAGCACAGGG - Intronic
948508035 2:238444234-238444256 GAATCAAGGCCTTCTGCTCAGGG + Intronic
1169879326 20:10329266-10329288 CAAACAAGGGCTTTAGCAGAAGG + Intergenic
1174454533 20:50639970-50639992 GAAGAGATGCCTTTAGCACAGGG - Intronic
1174472262 20:50769751-50769773 GAAGAGATGCCTTTAGCACAGGG + Intergenic
1176144941 20:63561391-63561413 AAATCAAGGCCTTTGACACCCGG - Exonic
1176941723 21:14933208-14933230 GAATCCAGGCCTTGAGAAAAAGG + Intergenic
1178281506 21:31286859-31286881 GACTCAAGGCCTTTTGACCATGG - Intronic
1183639924 22:39086655-39086677 GGATCAAGGCCTTTCCCACAGGG - Intronic
951647113 3:24905146-24905168 TAACCAAAGCCTTTACCACAGGG + Intergenic
953127245 3:40103126-40103148 CATTCAAGGCCTTCAGCACCTGG + Intronic
953282390 3:41571898-41571920 GCAACAAGGCCTTTGGGACAGGG + Intronic
953688385 3:45096097-45096119 GAAACAGGCCCTTTGGCACACGG + Intronic
956217718 3:66866767-66866789 AAATCAGTGCCTTGAGCACAAGG - Intergenic
957808956 3:85192471-85192493 GGCTCAAGGCACTTAGCACATGG - Intronic
960401114 3:117200020-117200042 GAATTAAGGTCTATAGGACATGG - Intergenic
961588775 3:127958980-127959002 GAATGAAGCCCTTCAGTACAAGG - Intronic
963834786 3:150047207-150047229 GAATCATGGCATTTGGTACAAGG + Intronic
964814822 3:160705799-160705821 GGATCATGGTCATTAGCACAAGG - Intergenic
969232890 4:5843887-5843909 GAATCTAGGCCATCAGCCCAGGG - Intronic
975854571 4:78609974-78609996 GAATCAAATCCTATAGCACTAGG - Intronic
977398748 4:96504534-96504556 TAATCAAGCACTTTAGCCCACGG - Intergenic
978306812 4:107337925-107337947 GAATCATGGGATTTAGAACATGG - Intergenic
980175714 4:129341505-129341527 GAATGAAAGCTTTTAGGACATGG - Intergenic
980539930 4:134179800-134179822 GAATCAAGGCCTTTACCATTAGG - Intergenic
981496971 4:145404893-145404915 GATTGAAGCCATTTAGCACAGGG + Intergenic
981601924 4:146499339-146499361 GAATCAGGGCCTTCATCAAATGG + Intronic
982056703 4:151557435-151557457 GTATCAATGTCTTTTGCACAGGG - Intronic
982104498 4:151999773-151999795 GAATCAAGGCATCTTCCACAAGG + Intergenic
983657776 4:170100189-170100211 CAACCAAGGCTTTTTGCACAGGG - Intergenic
984385775 4:179055794-179055816 GAGTCAAGGAGTTTAACACAGGG - Intergenic
985062977 4:186096564-186096586 TAACCAAGGCCCTTCGCACAGGG - Intergenic
992506262 5:77390249-77390271 TAAACAAAGCATTTAGCACAAGG + Intronic
995297864 5:110540950-110540972 GACTTAACGCCTATAGCACAAGG + Intronic
997884295 5:137616410-137616432 GAATTAAAGCATTCAGCACAGGG + Intergenic
999031727 5:148300407-148300429 GCATCAAGGCTTTTATCTCAGGG + Intergenic
1004263958 6:14132969-14132991 GCAGCGAGGCCTTTAGCCCAGGG - Intronic
1005638258 6:27771416-27771438 GAACCAAAGCCCTTAGTACATGG - Intergenic
1008619975 6:53262338-53262360 GAAAGAAAGCTTTTAGCACAGGG - Intergenic
1008652246 6:53575387-53575409 GAATCAGTGCCTTTACAACAGGG + Intronic
1008701953 6:54111474-54111496 GAATCAATGCTTTCAGAACAGGG + Exonic
1009035540 6:58113472-58113494 GAAGCAAAGCCTTCAGCAGAAGG - Intergenic
1009211360 6:60867066-60867088 GAAGCAAAGCCTTCAGCAGAAGG - Intergenic
1010590843 6:77710180-77710202 GAATCCAGGCCTTTTGTACCTGG + Intronic
1010837388 6:80606940-80606962 GAATTTATGCCTTTGGCACAAGG - Intergenic
1011841991 6:91512775-91512797 GAATCACAGCCTTTAGCTCAGGG + Intergenic
1012324751 6:97903074-97903096 GAATGATGGCCTTGAGCATAAGG + Intergenic
1015366092 6:132400254-132400276 GGATCAAGACTTTTAGCAAAGGG + Intronic
1018444197 6:163840326-163840348 CAATCATGGTCTTTTGCACAAGG + Intergenic
1019930966 7:4222850-4222872 GAATCAAAGTCATTAGCAAAGGG - Intronic
1023136900 7:37061641-37061663 GAATCAAGTCATTTAGCAATGGG + Intronic
1026497248 7:70913882-70913904 ATATCAAGGAATTTAGCACAGGG - Intergenic
1031597080 7:123660620-123660642 GAATCAGGGCCTGGAGGACAGGG + Intronic
1033767588 7:144511039-144511061 TCATCAAGTCCTTTAGGACATGG - Intronic
1037820255 8:22131698-22131720 AAATCAAGGCCCTTAGACCAGGG - Exonic
1038426117 8:27465016-27465038 CAGTCAAGGCCTTTTGCAAACGG - Intronic
1040747645 8:50664643-50664665 TACCCAAGGCCTTTAGCCCAGGG + Intronic
1042413195 8:68488250-68488272 GAGTCAAGGCCTTTAGAATTTGG + Intronic
1042514529 8:69645291-69645313 GAAACAAGGCCTTTGGAATAGGG - Intronic
1043684469 8:83069059-83069081 GACTTAACTCCTTTAGCACAAGG + Intergenic
1044020281 8:87097374-87097396 GAATCATGGCCTTAACCACTTGG - Intronic
1044587013 8:93877432-93877454 GAATCAACCTCTTTAGCACCAGG - Intronic
1045110319 8:98934172-98934194 GAATCCAGGGCTTCAGTACAGGG + Intronic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1046422836 8:114007379-114007401 GAATCAAGACCATTTGCACAAGG + Intergenic
1046501795 8:115087209-115087231 GCATCAAAGTCTTTAGCACAGGG - Intergenic
1049262113 8:141645469-141645491 GACGCCAGGTCTTTAGCACAGGG + Intergenic
1058848264 9:108984078-108984100 GAATTAAGGCCTGTCACACATGG - Intronic
1188098469 X:26051822-26051844 GAATGAGGCCCTATAGCACAAGG + Intergenic
1191961797 X:66711579-66711601 GAATCAACTCATTTAGCAGATGG - Intergenic
1193374049 X:80736742-80736764 GGATCAAGGCCTTTATCATGTGG + Intronic
1195162404 X:102183478-102183500 CTATCAAGGCCTTAAGGACATGG + Intergenic
1195166446 X:102225075-102225097 CCATCAAGGCCTTAAGGACATGG + Exonic
1195192414 X:102462013-102462035 CCATCAAGGCCTTAAGGACATGG - Exonic
1197794574 X:130285595-130285617 GACTCAACCCCTATAGCACAAGG + Intergenic