ID: 1088075658

View in Genome Browser
Species Human (GRCh38)
Location 11:105845439-105845461
Sequence GACCCCTGCAGTTCAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088075654_1088075658 2 Left 1088075654 11:105845414-105845436 CCTGGAGACAAGGAGAGGGAACC 0: 1
1: 0
2: 5
3: 36
4: 276
Right 1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG 0: 1
1: 1
2: 0
3: 16
4: 131
1088075652_1088075658 6 Left 1088075652 11:105845410-105845432 CCTGCCTGGAGACAAGGAGAGGG 0: 1
1: 0
2: 4
3: 58
4: 566
Right 1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG 0: 1
1: 1
2: 0
3: 16
4: 131
1088075648_1088075658 22 Left 1088075648 11:105845394-105845416 CCTCAGCAGTCACTAGCCTGCCT 0: 1
1: 0
2: 1
3: 26
4: 227
Right 1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG 0: 1
1: 1
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088075658 Original CRISPR GACCCCTGCAGTTCAGTGGG AGG Intronic
900339703 1:2182234-2182256 GGGCCCTGCAGTGGAGTGGGGGG + Intronic
900792098 1:4687488-4687510 GACCCCTGCGGTCCATGGGGAGG + Intronic
903225265 1:21890959-21890981 GACCCCCACAGTTCAGAGGAAGG + Intronic
905103348 1:35545073-35545095 GGCCCCAGAAGTCCAGTGGGAGG + Intronic
906399909 1:45497347-45497369 CACTCCTGCAGTGCTGTGGGAGG - Exonic
907289414 1:53403232-53403254 CACCCCTGCAGTGCAGTGAATGG - Intergenic
911719708 1:101177607-101177629 GAACCATGCAGCACAGTGGGAGG + Intergenic
912567798 1:110600958-110600980 GACCCCTGCAATTCACTGTTTGG + Intronic
916017421 1:160762447-160762469 GACCTCTGCATGTCAGAGGGTGG - Intergenic
919761568 1:201101509-201101531 GACCCCTGCAGCTCAGGTAGAGG - Intronic
920977178 1:210797218-210797240 GACATTTGCAGTACAGTGGGAGG - Intronic
921183716 1:212652321-212652343 AAAACCTGCAGTTCAGAGGGAGG - Intergenic
923888786 1:238187907-238187929 GACCCCTGCAGGTGAGCAGGAGG + Intergenic
1066084467 10:31962889-31962911 GATCTCAGGAGTTCAGTGGGTGG - Intergenic
1067268317 10:44766895-44766917 GTGCCCTGCAGACCAGTGGGAGG - Intergenic
1069203491 10:65653312-65653334 GACCACAGCACTTCAGTGGATGG - Intergenic
1069725115 10:70572491-70572513 GACCCGTGCAGCCCCGTGGGTGG + Intergenic
1072235278 10:93448213-93448235 GAGCCATGCAGTTCATTGGGGGG - Intronic
1076190570 10:128480494-128480516 GACCCTTACAGTTCAGTTGCAGG - Intergenic
1076695217 10:132244109-132244131 GACCCCTCCAGGTCAGTGACAGG + Intronic
1080063135 11:27979355-27979377 GACACCTGAAGTTCAGAGAGGGG + Intergenic
1081722229 11:45298787-45298809 GAGCCTCGGAGTTCAGTGGGGGG - Intergenic
1083741188 11:64712540-64712562 GGCCCCTGAAGGACAGTGGGTGG - Intronic
1083761925 11:64823471-64823493 GCCCCCCACACTTCAGTGGGGGG + Exonic
1085666475 11:78418805-78418827 AACCCCAGCACTTCAGCGGGAGG + Intergenic
1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG + Intronic
1089705082 11:120271991-120272013 CTCACCTGCAGGTCAGTGGGTGG + Intronic
1091296138 11:134475239-134475261 GCCACCTGCAGTTTGGTGGGGGG - Intergenic
1091769009 12:3139408-3139430 GTCCCCTGCCGTGCAGTGGAGGG + Intronic
1097371405 12:58785859-58785881 GACCAGTGCCATTCAGTGGGAGG + Intronic
1097946328 12:65372788-65372810 GAGCCCTGGAGGTCAGTGTGTGG + Intronic
1103292045 12:119854596-119854618 GTCCGCTGGAGTTCAGTGGCCGG - Intronic
1106128243 13:26918969-26918991 GTTCCCTGCAGATCTGTGGGAGG - Intergenic
1108519660 13:51234905-51234927 GACCTGTGCAGTTCTGTGAGGGG - Intronic
1108610034 13:52076318-52076340 AACACTTGCACTTCAGTGGGTGG + Intronic
1112942007 13:104875027-104875049 GAATCATGCAGTTCAGTGGTAGG + Intergenic
1113404395 13:110024386-110024408 GACCTCTGCTGTTCCGCGGGTGG - Intergenic
1113825070 13:113246271-113246293 GCCCCCTGCAGGTCAGCAGGTGG - Intronic
1113936858 13:113999468-113999490 GAAGCCTGGAGTGCAGTGGGTGG + Intronic
1115203302 14:30875305-30875327 GGCCCCTGGGGTCCAGTGGGGGG + Intronic
1118590934 14:67400514-67400536 GACCCCTGCAGTTGGGGCGGGGG - Intronic
1124135919 15:27036301-27036323 GAGCCCTGCAGACCAGTGTGAGG + Intronic
1130225625 15:82056353-82056375 GGAGCCTGCAGTTCAGTAGGGGG - Intergenic
1130353169 15:83108552-83108574 GATCCCTGCAGTGGAGTGGGAGG - Intronic
1130398757 15:83529695-83529717 CATCCCTGCTGCTCAGTGGGTGG + Intronic
1133115496 16:3576041-3576063 GACCCCTGGAGTCCAAGGGGTGG + Intronic
1133776161 16:8896920-8896942 GACCTCTGCAGTTGCGTTGGTGG - Intronic
1136053918 16:27673701-27673723 GTCCCCTGGAGTTGGGTGGGGGG + Intronic
1140890629 16:79281884-79281906 GAACCCTGCATTTCTGTGTGTGG + Intergenic
1141592468 16:85077805-85077827 CATCCCTGCATGTCAGTGGGGGG - Intronic
1141928515 16:87184939-87184961 CACCCCTGCACTCCAGTGTGAGG + Intronic
1145139694 17:20442167-20442189 GACCTCTGCAGTTTGGTTGGAGG + Intergenic
1145411462 17:22669613-22669635 GACCCCCGCAGTCCAGTCGCAGG + Intergenic
1145863893 17:28227990-28228012 CAGCCCTGCAGCTCAGGGGGCGG - Intergenic
1147638494 17:41978991-41979013 GTCCTCTCCAGTTCAGTGTGGGG - Intronic
1148787473 17:50152298-50152320 CACCCCTGCAGTGGAGTGGTAGG - Intergenic
1151627220 17:75284511-75284533 GACCCCTTCAGTGCAGCTGGCGG + Intronic
1151980211 17:77504111-77504133 AACCACTGCAGTTAACTGGGAGG + Intergenic
1152760037 17:82103025-82103047 GACCCAGGCAGGTCAGCGGGCGG + Intronic
1152937958 17:83151712-83151734 GCTCCCTGCAGCTCAGTGTGAGG + Intergenic
1155167627 18:23244354-23244376 AACCCTTTCATTTCAGTGGGAGG + Intronic
1155503089 18:26506274-26506296 CAGTCCTGCTGTTCAGTGGGAGG + Intronic
1156880532 18:42072571-42072593 TACCACTGCACTCCAGTGGGGGG - Intronic
1157403556 18:47405605-47405627 GGCACCTGCAGTTCAGCAGGCGG - Intergenic
1166568664 19:43780166-43780188 GACCCCTGGAGGCCAGAGGGTGG - Intronic
1167393377 19:49211242-49211264 GACCCAGGCAGGTCAGGGGGTGG - Exonic
925018004 2:546306-546328 GCTCCCTGGAGTTCGGTGGGAGG - Intergenic
925663082 2:6223394-6223416 GGTCCCTGCAGTGCAGAGGGGGG - Intergenic
929444149 2:41989693-41989715 GACTCCTGCAGATCAGGGGTTGG - Intergenic
932485669 2:72082889-72082911 GAGCCCTGGAGTACAGTAGGGGG - Intergenic
932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG + Intronic
938117159 2:128609762-128609784 GCCCTCTGCAGGTCAGTGGCAGG + Intergenic
939856771 2:147367679-147367701 AACCCATGCAGTTCATTGTGTGG + Intergenic
942276575 2:174327761-174327783 GAACCCTACAGTTCAGTGAGAGG - Intergenic
943351982 2:186806448-186806470 CTCCCCTGCATTTCAGTAGGAGG - Intergenic
947314619 2:228842436-228842458 GTCCACTGCAGGTCAGTGGGAGG - Intergenic
948757805 2:240169349-240169371 GGCCCCTGAAGTGCCGTGGGAGG + Intergenic
1170546541 20:17439766-17439788 GAACCCTTCAGCGCAGTGGGTGG + Intronic
1171099454 20:22368875-22368897 CACCCATGCAGTAGAGTGGGGGG - Intergenic
1171487276 20:25494081-25494103 GACCCATGGGGTGCAGTGGGGGG - Intronic
1171542732 20:25976908-25976930 GACCCCAGCAGTCCAGTCGCAGG + Intergenic
1171798324 20:29583616-29583638 GACCCCAGCAGTCCAGTCGCAGG - Intergenic
1173191973 20:40883620-40883642 GACACCTGGAGTGCAGTGAGGGG + Intergenic
1173361167 20:42346008-42346030 CACTCCAGCAGTTCAGTGGGGGG + Intronic
1175357836 20:58382931-58382953 GAACCCAGGAGCTCAGTGGGAGG - Intergenic
1175391618 20:58631295-58631317 GAACCCAGAAGTCCAGTGGGGGG + Intergenic
1175862557 20:62158010-62158032 GACCCCTGCTGATCCTTGGGAGG + Intronic
1176219505 20:63963330-63963352 GCCCCCAGGAGGTCAGTGGGGGG - Exonic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1183287942 22:36979536-36979558 GAGCCCTGCAGTTCAGTGGGTGG - Intergenic
1184581927 22:45423753-45423775 GACCTTTGCAGCTCACTGGGTGG - Intronic
950011873 3:9729769-9729791 GAACCCTGGACTTCACTGGGAGG + Exonic
950270963 3:11614536-11614558 GCCCACTGCAGCTCCGTGGGGGG - Intronic
950520738 3:13496352-13496374 GTCCCCTTCTGTACAGTGGGTGG + Intronic
953981438 3:47415093-47415115 GCCCCCTGCAGTTTAGAGGTCGG - Exonic
958465620 3:94453997-94454019 CACTCCTGCAGTTCAGTGAGTGG - Intergenic
961451237 3:127003249-127003271 GACCCCTGACCTTCTGTGGGGGG + Intronic
961959521 3:130840033-130840055 GACACCTGCTGTTAAGTGGGGGG + Intergenic
968459639 4:718160-718182 GACGGCTGCACGTCAGTGGGCGG - Intronic
968599955 4:1504095-1504117 GACTTCTGCAGCTCAGCGGGTGG + Intergenic
968663788 4:1809996-1810018 GAGGCCTGCAGGGCAGTGGGGGG + Intergenic
969082853 4:4633230-4633252 GACCCCTGATGCTCAGAGGGAGG - Intergenic
972316455 4:37931222-37931244 GGCACCTGCAGTTCCTTGGGAGG - Intronic
972431109 4:38983075-38983097 GGCCCCAGCAGTTCAGAGGGGGG + Intronic
980142839 4:128941907-128941929 CACCATTGCAGTTCAGTGGGGGG - Intronic
981006970 4:139885177-139885199 GATCGCTTCAGTTCAGTGGTTGG + Intronic
981392013 4:144202101-144202123 GACCCCTTCTTTTCAATGGGAGG + Intergenic
983838522 4:172424571-172424593 GATGCCTCCAGTTCAGTGGGCGG + Intronic
985409225 4:189665181-189665203 GGCCCCTACAGTGCAGTGGTGGG + Intergenic
985725919 5:1515666-1515688 GGCTCCTGCAGCTAAGTGGGTGG - Intronic
986030861 5:3891259-3891281 GACCTGTGAAGCTCAGTGGGGGG + Intergenic
988454905 5:31378931-31378953 CAGCCCTGGAGTTCATTGGGGGG - Intergenic
990545604 5:56817031-56817053 GGCCCCTGGAATTCAGCGGGCGG - Intronic
991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG + Intergenic
993355332 5:86899778-86899800 GACCCTTGCAGAACTGTGGGTGG - Intergenic
998083372 5:139294595-139294617 GCCGCCTGCAGTACAGTGCGAGG + Intronic
1004425557 6:15504672-15504694 GACCCCTGCAGCTCGGTGAACGG + Intronic
1007788738 6:44297191-44297213 GAAACCGGCAGTGCAGTGGGAGG + Intronic
1013081547 6:106817202-106817224 GGCTCCCGCAGTGCAGTGGGGGG + Intergenic
1019298605 7:291506-291528 GGCCCCTGCAGTTCAGTCTGGGG + Intergenic
1019667775 7:2260662-2260684 CACCCTTGCTGTTCAGTCGGGGG - Intronic
1023200106 7:37687796-37687818 GACCCCTGCACTTCCCTGGAAGG + Intronic
1028322350 7:89476187-89476209 GACCTCTGCAGTCCAGAGGCAGG + Intergenic
1034693977 7:153037887-153037909 CACCACTGCAGTTGAGTGAGGGG - Intergenic
1036837597 8:12088682-12088704 GACCCCCACAGTGCAGTGGCGGG - Intergenic
1036859391 8:12334930-12334952 GACCCCCACAGTGCAGTGGCGGG - Intergenic
1037208329 8:16353375-16353397 GACCACTGCAGGTCAGATGGTGG + Intronic
1040078844 8:43267733-43267755 GACCCCTGCACTCCAGTGTGGGG - Intergenic
1040571336 8:48614129-48614151 GACAGCTCCATTTCAGTGGGTGG + Intergenic
1041700744 8:60786462-60786484 GTCCACTGCAGTTCACTGGATGG - Intronic
1043844859 8:85152593-85152615 GGCCCCCACAGTTCAGTGGTGGG - Intergenic
1045695168 8:104801094-104801116 GATCACTGGAGTTCAGTGGGTGG + Intronic
1049423967 8:142529087-142529109 CACCCCCGCAGTTCTGTGGTGGG + Intronic
1049546243 8:143232727-143232749 GACCCCTGGAGCCCAGTGCGGGG + Intergenic
1052720411 9:32166525-32166547 CACCCCTGCACTTCAGTTGTGGG + Intergenic
1053430766 9:38040439-38040461 CACCCATGCAGTGCAGTGGAGGG + Intronic
1054162307 9:61682287-61682309 GACCCCAGCAGTCCAGTCGCAGG - Intergenic
1056965719 9:91161605-91161627 GACAGCTGCATTTCCGTGGGTGG - Intergenic
1057628704 9:96701358-96701380 GACTCCCACAGTGCAGTGGGGGG + Intergenic
1060402035 9:123354891-123354913 GTCCCCTGCAGTGCAGGGGAGGG - Intergenic
1060807079 9:126584575-126584597 GAAACTTCCAGTTCAGTGGGGGG + Intergenic
1062286778 9:135776763-135776785 GACCCCCTCAGTTCACTGGGTGG + Intronic
1187127786 X:16470111-16470133 GCCCCCAGCAGTTCAGTTGGTGG - Intergenic
1189124479 X:38431751-38431773 AACCCCTTCAGGTCAGTGGATGG + Intronic
1192564724 X:72154076-72154098 GAACCCTGCAGTTCAGGGTCTGG + Intergenic
1196515542 X:116606396-116606418 CACCCCATCACTTCAGTGGGTGG - Intergenic
1198235801 X:134734872-134734894 GGCCCCAGCAGTCCAGGGGGTGG - Intronic
1199467991 X:148161373-148161395 TACCCTTGCAAGTCAGTGGGTGG - Intergenic
1199748626 X:150793523-150793545 GAGCCATGCAGTTCAAGGGGGGG - Intronic