ID: 1088076232

View in Genome Browser
Species Human (GRCh38)
Location 11:105851931-105851953
Sequence CTACTGTTCCATTTCTATAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088076230_1088076232 13 Left 1088076230 11:105851895-105851917 CCACTGGAATGTAAGCTTCATGA 0: 1
1: 34
2: 198
3: 633
4: 1750
Right 1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG 0: 1
1: 0
2: 1
3: 18
4: 167
1088076229_1088076232 19 Left 1088076229 11:105851889-105851911 CCTCAGCCACTGGAATGTAAGCT 0: 1
1: 2
2: 6
3: 38
4: 326
Right 1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG 0: 1
1: 0
2: 1
3: 18
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088076232 Original CRISPR CTACTGTTCCATTTCTATAT CGG Intronic
905266366 1:36756724-36756746 CTGCTTTTCCATTTCTCTAAGGG - Intergenic
905619621 1:39432191-39432213 CTACTGTTCCATGTCTGGGTAGG + Intronic
907944677 1:59124625-59124647 CTACAGATCCACCTCTATATGGG - Intergenic
908051647 1:60239323-60239345 CTATTTTTCCATTTCGAAATGGG - Intergenic
910389363 1:86722568-86722590 CTGCTGTTCCAATTCTTTTTTGG - Exonic
911554179 1:99323018-99323040 CTACTTTTTCATTTCTTTTTTGG - Intergenic
914905525 1:151740521-151740543 CTACTGTTACAATTAAATATTGG - Intergenic
916262649 1:162857787-162857809 CTACTGTCCAATTTAAATATGGG + Intronic
918520328 1:185407811-185407833 CTACCGTCCCATCTCTAAATGGG + Intergenic
919147003 1:193648529-193648551 CTAGACTTCCATTACTATATTGG + Intergenic
920745362 1:208622641-208622663 ATTCTGTTCCATTTGTCTATGGG - Intergenic
921441269 1:215189428-215189450 ATACTGTTCCATCTTTATAAAGG + Intronic
922354268 1:224761130-224761152 CCACTGTGCCATTTCTAAATAGG - Intergenic
922627843 1:227068268-227068290 TTACTGTTTAATTTCTATGTTGG - Intronic
924162651 1:241249413-241249435 CTACTGTTCCCTTGAAATATTGG + Intronic
924408903 1:243782656-243782678 GCATTGTTCCATTTATATATGGG - Intronic
1068251507 10:54448448-54448470 CAAATGTTCCATTTTTAAATTGG + Intronic
1070457653 10:76633036-76633058 CACTTGTTCCATTTCTATTTCGG - Intergenic
1071062170 10:81584834-81584856 CTGCTTTGCCATTTCTTTATTGG + Intergenic
1073503267 10:103962280-103962302 ATACTTTTCCATTTGTATATTGG - Intergenic
1076180340 10:128402140-128402162 CTCCATTTCTATTTCTATATGGG - Intergenic
1076313167 10:129522376-129522398 CTACTGTTCCTTTCCTGTGTGGG + Intronic
1079648176 11:22893531-22893553 CCACTTTTGCATTTCTATAAAGG + Intergenic
1088076232 11:105851931-105851953 CTACTGTTCCATTTCTATATCGG + Intronic
1088992029 11:114961939-114961961 CTTTTGTTCCATTTCTTTAAGGG + Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1093582775 12:20803153-20803175 CAAGTGTTACATTTTTATATAGG + Intergenic
1095353508 12:41243716-41243738 GTACTTTTTCATTTCTCTATGGG + Intronic
1098303409 12:69077782-69077804 CTATTCTTGCATTTCTATAAAGG + Intergenic
1098826382 12:75302760-75302782 GTACTTTTCCATATGTATATAGG - Intronic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1101338403 12:103818319-103818341 TGACAGTTCCATTTCTTTATTGG + Intronic
1104663527 12:130630418-130630440 CTACTGATACATATATATATAGG - Intronic
1109068851 13:57737166-57737188 CTACTGTTGCAGTTCAATAAAGG + Intergenic
1110384079 13:74888334-74888356 TTACTCTTCCATTTCTCCATAGG - Intergenic
1114870513 14:26650189-26650211 CTACTGCTCCTTTTCACTATAGG + Intergenic
1116337255 14:43672810-43672832 ATTCTGTTCCATTTATTTATTGG + Intergenic
1116581467 14:46647777-46647799 ATACTGTTCAATTTCTCTACCGG + Intergenic
1116794631 14:49376509-49376531 CTTCTATTCCACTTGTATATGGG + Intergenic
1116937134 14:50752330-50752352 CTACGTTTCCATTTGTATTTGGG + Intronic
1118127426 14:62922967-62922989 TTACTGTTTCCTTTCTAAATTGG - Intronic
1120021053 14:79530499-79530521 TTTCTGTACCATCTCTATATGGG + Intronic
1121017729 14:90558549-90558571 CTATTTTTCCATTTTTAAATAGG + Intronic
1124588594 15:31033873-31033895 CTACTGTTCCTTTTCTAGCTGGG - Intronic
1125521945 15:40353038-40353060 CTACAGTGCCAGCTCTATATTGG + Intronic
1130222021 15:82027576-82027598 CAAGTGTTCCATTTCTACCTGGG - Intergenic
1132009190 15:98259587-98259609 CTACTGTACAGTTTCTTTATTGG - Intergenic
1135238810 16:20784296-20784318 CTAGTGTTCAATATCCATATAGG + Intronic
1137307333 16:47216020-47216042 CTAATGTTCCATTACTGTTTTGG + Intronic
1138902577 16:61291997-61292019 CTACTGTTCCATTTAACTCTAGG - Intergenic
1139210188 16:65069627-65069649 CTATTTTTCCGTTTCTATTTTGG - Intronic
1139532965 16:67552472-67552494 CTTCTGTTCCATTCCTTAATTGG - Intergenic
1141294492 16:82754285-82754307 ATGCAGTTCCATTTCTATGTGGG - Intronic
1146419261 17:32667294-32667316 TTCCTCTTCCATTTCTATAAGGG + Intronic
1146449782 17:32963868-32963890 CTACTGCACCATTCCTATATTGG - Intergenic
1146774496 17:35600884-35600906 CTACGCTGCCATTTCTATCTGGG - Intronic
1151071207 17:71214433-71214455 ATACAGTTCCCTTTCTATCTTGG - Intergenic
1151112867 17:71700163-71700185 CTAGTACTCCATTTTTATATGGG + Intergenic
1155436148 18:25815185-25815207 CTGCTGTTCCATCTCTGTCTGGG + Intergenic
1156633641 18:38999506-38999528 CTTCTGTTCCACTTCTCTGTGGG + Intergenic
1157995147 18:52545909-52545931 CAACTTTTCCAATTTTATATTGG + Intronic
1159970895 18:74650878-74650900 CTACATTTCCATTTCTGTAGTGG + Intronic
1160045642 18:75384804-75384826 GTGCTGTTTCATTTCCATATTGG + Intergenic
1166587510 19:43963170-43963192 ATAATGTTCCATTTTTATATTGG + Intronic
1167796382 19:51712401-51712423 CAACTGTTCCATTTCTATTTCGG - Intergenic
925195560 2:1921770-1921792 TTACTGTTCAATTTCTATCAGGG + Intronic
925270568 2:2604277-2604299 CCACTGTACCATTTCTGTGTTGG + Intergenic
926551530 2:14307445-14307467 CTACTGTACCATCTCCATATTGG - Intergenic
926595960 2:14789746-14789768 ATACTGATCCATTTGTTTATGGG + Intergenic
928077610 2:28279393-28279415 ATACTGTGCCATTTTTATTTAGG - Intronic
929036293 2:37695194-37695216 CTACTCTTCCATTAATATGTTGG + Intronic
930792516 2:55348979-55349001 CTAATGTTTCATTTTTATTTGGG - Intronic
932829568 2:74976083-74976105 CTACTGTAACATTTGCATATAGG + Intergenic
934638086 2:96009382-96009404 CATAGGTTCCATTTCTATATCGG + Intergenic
934905472 2:98197540-98197562 TTCCTTTTACATTTCTATATTGG + Intronic
935613387 2:105050064-105050086 CTACAGTACCATTTATAAATAGG - Intronic
936456639 2:112680094-112680116 ATAATGTACCATTTCTATAACGG - Intergenic
937407236 2:121641527-121641549 AAACTATTCCATTTCTAGATGGG - Intronic
938509827 2:131929206-131929228 CTTCTGTTCCATTGGTCTATAGG - Intergenic
939193774 2:138947376-138947398 CTACTTTTGCATTTTTAGATAGG + Intergenic
940395667 2:153187725-153187747 CTACTCTTCTATTCCTTTATCGG + Intergenic
942422246 2:175820291-175820313 ATTCTATTCCATTTCTATACAGG - Intergenic
944386523 2:199170731-199170753 TCACTGTTGCATTTCTATTTGGG - Intergenic
946968038 2:225059807-225059829 CTCCTTTTTCATTTCGATATTGG + Intergenic
1169702653 20:8465459-8465481 CTGCTGTTCCAATTGTATAAGGG + Intronic
1177306635 21:19326970-19326992 CTACTTTTTCAGTTTTATATAGG + Intergenic
1178597202 21:33964681-33964703 CTATTTTTCCATCTCTATACTGG - Intergenic
1181693301 22:24578547-24578569 GCACTGTTCCAATTCTTTATGGG - Intronic
1181894537 22:26095434-26095456 CTATTTTTCCATTTCTAAAATGG - Intergenic
1183851570 22:40593487-40593509 CTATTGTTCTACTTTTATATTGG - Intronic
949653432 3:6188397-6188419 CTATTGTTACATTTTTAAATGGG + Intergenic
950529017 3:13541812-13541834 TTACTATTCTATTTCTATCTTGG + Intergenic
950762117 3:15240451-15240473 CTCCTGTTTCTTTTTTATATAGG + Exonic
951931343 3:27970540-27970562 AGACAGTTCCATTTCTATATTGG - Intergenic
953594868 3:44301170-44301192 CAACTGTTCCATTTCTACAAAGG - Intronic
953965855 3:47305938-47305960 CGACTGTTTCATTCCTGTATTGG + Intronic
955036705 3:55274909-55274931 CTGCTGTTTCATGTCTCTATTGG - Intergenic
956650425 3:71499731-71499753 CTTCTGTTCCCTTTCTATTTTGG - Intronic
957527402 3:81394844-81394866 CTACTGTTCCATTTAGCTAAAGG - Intergenic
957751290 3:84420237-84420259 TTATTGTTCCATTTCTACACAGG + Intergenic
958746631 3:98143623-98143645 CTTCTCTACCATTTCTATATTGG - Intergenic
959322560 3:104896189-104896211 CTACTTCTCATTTTCTATATTGG + Intergenic
960272446 3:115689730-115689752 CTACTCTCCCTTTTCTCTATAGG - Intronic
961161211 3:124727957-124727979 CTAATATTCCATAACTATATTGG - Intergenic
963466985 3:145694908-145694930 TTACATTTCCATTTCTAAATGGG + Intergenic
969134299 4:5017818-5017840 ATACTTTTATATTTCTATATTGG + Intronic
970092438 4:12425885-12425907 CTGCTGTTTCATTTCTTTATTGG + Intergenic
970107701 4:12603533-12603555 CAACTTTTCTATTTCAATATAGG + Intergenic
970265256 4:14275979-14276001 CTATTGTTCCAATTCCACATAGG + Intergenic
972187151 4:36543650-36543672 CTTCTCTTCCATTTCCTTATAGG + Intergenic
972193203 4:36619742-36619764 TTACTGTTCCATTTCCAATTTGG - Intergenic
973609555 4:52622221-52622243 TTAATGTTCCATTTTTTTATAGG + Intronic
974737645 4:65958797-65958819 ATTCTGTTCCATTTGTCTATGGG - Intergenic
976926272 4:90500819-90500841 CTACTGTTAATTTCCTATATTGG - Intronic
978720839 4:111907149-111907171 GTAATGTTGCATATCTATATCGG + Intergenic
980262586 4:130471497-130471519 TAAGTATTCCATTTCTATATCGG - Intergenic
983325055 4:166243759-166243781 ATTCTGTTCCATTTATATATGGG + Intergenic
983416394 4:167460640-167460662 CTACTTTTTGAGTTCTATATGGG + Intergenic
984513160 4:180703251-180703273 CTAATGTTCGATTTGTTTATAGG + Intergenic
985049816 4:185978325-185978347 CTCCTCTTCCATTCCTATAGTGG - Intergenic
986614625 5:9603764-9603786 CAAATGTACCATTTCTCTATAGG + Intergenic
988192108 5:27950936-27950958 CTACAGCTCCATTTCTTTTTTGG + Intergenic
989752288 5:44910126-44910148 CTTCTGTTAGATTTCTTTATAGG - Intergenic
990825904 5:59897408-59897430 CTAAGGGTCCATTTCTATCTTGG + Intronic
991920145 5:71648411-71648433 CTATTTTTCCATTTCAATAGAGG - Intronic
992027642 5:72686473-72686495 CTACTGCACCATGTATATATGGG - Intergenic
993174883 5:84471121-84471143 CCACTGTTCCACTTTTATAGAGG - Intergenic
994564215 5:101420216-101420238 CTACTGTTGCATTTTTAGCTTGG + Intergenic
994797832 5:104329388-104329410 CTACTATCCCCTTTCTATAGAGG + Intergenic
995351888 5:111186716-111186738 CTTCTGTTACATTTTTATGTAGG + Intergenic
995462972 5:112421484-112421506 TTTCTTTTCCATTTCTTTATCGG + Intergenic
996497599 5:124179138-124179160 CTACTGCTCCTTTGCTCTATAGG - Intergenic
996539483 5:124614306-124614328 CTAATGTTGCATATCTAAATAGG + Intergenic
998300399 5:141013207-141013229 CTCCTGTTCCATTTCAAAAGTGG - Intergenic
998607677 5:143651793-143651815 ATATTATTCCATTTTTATATAGG - Intergenic
998671509 5:144359168-144359190 CTACTGTGCCCTGTCTCTATAGG + Intronic
998707789 5:144783812-144783834 CAACTGTGGAATTTCTATATAGG - Intergenic
998771879 5:145555071-145555093 CTACTTATCTATTTATATATTGG - Intronic
1003344033 6:5248732-5248754 ATTCTGTTCCATTTCACTATTGG + Intronic
1004852745 6:19716992-19717014 CTACTGTGACATCTATATATAGG + Intergenic
1005265789 6:24111012-24111034 CAGCTCTTCCATTTCTAGATGGG + Intergenic
1007160959 6:39791821-39791843 CAACTTTTCCATTTCTTTTTTGG - Intergenic
1007877359 6:45120555-45120577 CTATTGTGGCATTTATATATTGG - Intronic
1011680112 6:89774997-89775019 TTACTGTTCACTTTCTCTATTGG - Intronic
1011945878 6:92902349-92902371 CTAATGTTCTATTTCCATATAGG - Intergenic
1012016692 6:93861284-93861306 CTAATGTTCCATTTTTATTATGG - Intergenic
1012324270 6:97895499-97895521 ATACTGTACCAGTTATATATTGG - Intergenic
1012642703 6:101639818-101639840 ATACTGTTCCACTTCTAACTTGG - Intronic
1014401909 6:121000268-121000290 CTACTGTGCCACTTCTATGATGG - Intergenic
1014723197 6:124943802-124943824 ATTCTGTTCCATTACTCTATTGG + Intergenic
1015162000 6:130163432-130163454 CTACTGTTCAAGTTCCATAGGGG - Intronic
1018626387 6:165782848-165782870 CTCCAGTTCCATTTCTGTATGGG + Intronic
1020643743 7:10788245-10788267 CTACTGTGCCATTTTTAAAAAGG + Intergenic
1020965971 7:14868725-14868747 CTTCTCTTCCATTTCTAAAGAGG - Intronic
1021298078 7:18934326-18934348 GTACTTTTCCATTCCTGTATTGG - Intronic
1028421066 7:90633552-90633574 CTACTGTTCCATTTATTTTACGG + Intronic
1030474079 7:110005940-110005962 CTCCTGTTCCAATAATATATAGG - Intergenic
1032648314 7:133850534-133850556 CTAATATTCCATTTCTCTTTGGG + Intronic
1035596311 8:860866-860888 CTACTTTACCATTTCTTCATAGG - Intergenic
1037932677 8:22891600-22891622 CAAATGTTCCATTTATTTATAGG + Intronic
1038839531 8:31169732-31169754 CTACTCTGCCATTTTTATCTGGG + Intronic
1039733709 8:40307112-40307134 TAAATGTTCCAGTTCTATATGGG + Intergenic
1042239969 8:66653945-66653967 CCACTGTTCCATTGCTTTAAGGG + Intronic
1043089711 8:75883196-75883218 CTACTGCTCCATTTCTGTTGTGG + Intergenic
1045613852 8:103882570-103882592 CCACTGTTCCATTTTTATAGTGG + Intronic
1045760054 8:105594734-105594756 CTACAGTTCCATTTTAATAATGG + Intronic
1046249955 8:111617016-111617038 ATACTATGCCATTTTTATATAGG + Intergenic
1046332787 8:112742846-112742868 CTGCTGTTCCCATTCTCTATAGG - Intronic
1046725763 8:117671911-117671933 CTAGTGTTCCAGTTCTAGAAAGG + Intergenic
1047822677 8:128538734-128538756 CTTCTGTTCCAATTCTACATTGG - Intergenic
1047945817 8:129878234-129878256 CTTTTATTCCATTTCTATAAAGG - Intronic
1048382258 8:133876358-133876380 GTTCTGTTCCATTTTTCTATAGG + Intergenic
1050190710 9:3022894-3022916 CTCCTGTTCCATCTGTTTATTGG - Intergenic
1050284695 9:4089219-4089241 GTACTGTTCCATTTATACAATGG - Intronic
1050967742 9:11829115-11829137 CTACTGTTTCATTACTTTATTGG - Intergenic
1051132499 9:13878032-13878054 CTGCTGTTCCATTGCTCCATAGG + Intergenic
1052086918 9:24279115-24279137 TTATTGATACATTTCTATATTGG - Intergenic
1056040918 9:82666231-82666253 CTACAGTTGCATTTCTGTACTGG + Intergenic
1057959652 9:99442103-99442125 ATTCTGTTCCATTGGTATATGGG - Intergenic
1058403380 9:104642720-104642742 CTTCTGTTCCATTGGTCTATAGG - Intergenic
1061081255 9:128371706-128371728 CTTCTTTTCCATTCCTATCTCGG + Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1195617608 X:106925409-106925431 ATTCTGTTCTATTTCTATTTGGG + Intronic
1196255038 X:113507490-113507512 ACACTATTCAATTTCTATATAGG - Intergenic
1196428166 X:115593245-115593267 CTACTGTTCAAACTCTAAATAGG + Intronic
1197117600 X:122851589-122851611 CTAGTGTTCCATTTCTCCCTGGG - Intergenic
1198789461 X:140327808-140327830 GTACTGTTTTATTTCTATGTAGG + Intergenic