ID: 1088077502

View in Genome Browser
Species Human (GRCh38)
Location 11:105869021-105869043
Sequence CTAGTCCAGCAGATCTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088077502_1088077507 -3 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077507 11:105869041-105869063 TAGTGCAAATGGAATTGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 155
1088077502_1088077504 -8 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077504 11:105869036-105869058 TGGACTAGTGCAAATGGAATTGG 0: 1
1: 0
2: 1
3: 11
4: 174
1088077502_1088077509 7 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077509 11:105869051-105869073 GGAATTGGTGGGGGTTAGAAAGG 0: 1
1: 0
2: 2
3: 19
4: 228
1088077502_1088077506 -4 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077506 11:105869040-105869062 CTAGTGCAAATGGAATTGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 149
1088077502_1088077505 -5 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077505 11:105869039-105869061 ACTAGTGCAAATGGAATTGGTGG 0: 1
1: 0
2: 0
3: 11
4: 150
1088077502_1088077508 -2 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077508 11:105869042-105869064 AGTGCAAATGGAATTGGTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 249
1088077502_1088077511 9 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077511 11:105869053-105869075 AATTGGTGGGGGTTAGAAAGGGG 0: 1
1: 0
2: 1
3: 16
4: 206
1088077502_1088077510 8 Left 1088077502 11:105869021-105869043 CCTTTACAGATCTGCTGGACTAG 0: 1
1: 0
2: 1
3: 8
4: 140
Right 1088077510 11:105869052-105869074 GAATTGGTGGGGGTTAGAAAGGG 0: 1
1: 0
2: 0
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088077502 Original CRISPR CTAGTCCAGCAGATCTGTAA AGG (reversed) Intronic
900314068 1:2048439-2048461 CCAGTCCAGCAGATCTCTGCAGG + Intergenic
902032244 1:13431278-13431300 CTAGTCCTGCAGATCTGGATGGG + Intergenic
902126868 1:14221708-14221730 CTTTTCCTGCAGATCTTTAAAGG - Intergenic
906464821 1:46068640-46068662 CTAGTACAGCAGATATGTACGGG + Intronic
910641269 1:89465246-89465268 CTAGCACAGGAGATCTGTAATGG - Intergenic
912319350 1:108696288-108696310 CCAGTCCCACAGATCTGTAGGGG - Exonic
912469730 1:109898231-109898253 ACAGTCCAGCAGAGCTGGAAGGG - Intergenic
917647762 1:177045797-177045819 CTATTCCTGCAGACCTCTAAGGG - Intronic
919722255 1:200850741-200850763 ATAGTCCAACAGATGAGTAATGG - Intronic
920597889 1:207291618-207291640 CTAGACCACCAGGCCTGTAATGG - Intergenic
923441278 1:234022963-234022985 CTAGTACAGCAGTACAGTAAGGG + Intronic
1068355869 10:55907506-55907528 CTAGGCCACCAGGTCTGTGATGG + Intergenic
1069917611 10:71797093-71797115 CTGGTCCACAGGATCTGTAATGG + Exonic
1071490542 10:86133568-86133590 CTAGGCCAGCACATCAGCAAGGG - Intronic
1071730480 10:88243727-88243749 CAAGGCCAGCAGCTCTTTAACGG + Intergenic
1072316621 10:94209883-94209905 TTAGTCCCACAGTTCTGTAAGGG + Intronic
1074472008 10:113735792-113735814 CCACTCCTGCAGATCTGCAAGGG - Intergenic
1080634804 11:34114424-34114446 CATGTCCAGCAGCTCAGTAATGG + Intronic
1080863029 11:36166897-36166919 CTAGTCTACCATATCTGTACTGG + Intronic
1083149443 11:60782749-60782771 ATAGTCCAGCAGGTCTGAGAGGG + Intergenic
1085054543 11:73395922-73395944 CTCTTCCAGCAGGTCTATAAAGG + Exonic
1085906799 11:80774151-80774173 CTAGGCCTCCAGACCTGTAATGG - Intergenic
1088077502 11:105869021-105869043 CTAGTCCAGCAGATCTGTAAAGG - Intronic
1088953888 11:114598775-114598797 CTAGGCCTGCAGGTCTGTGATGG + Intergenic
1089381910 11:118039370-118039392 CTGGCCCAGGAGTTCTGTAATGG + Intergenic
1089785982 11:120907612-120907634 CTAGTCCAGAAGATCTGTGAGGG - Intronic
1091996550 12:4998285-4998307 CTCCTCCCGCAGATCTCTAAAGG + Intergenic
1098131636 12:67357200-67357222 CTAGTGCAGTAGTTTTGTAAGGG + Intergenic
1098165191 12:67689592-67689614 CTAATCCAACAGAACTGGAAAGG - Intergenic
1107563240 13:41576573-41576595 CAAGTTCAGCATATCTATAATGG - Intronic
1108927368 13:55769736-55769758 CTAGACCTCCAGATCTGTGATGG - Intergenic
1109013202 13:56975827-56975849 CTAGGCCTCCAGACCTGTAATGG + Intergenic
1112827239 13:103405835-103405857 CAAGTCCAGTACATCCGTAAGGG - Intergenic
1114406511 14:22462060-22462082 CCTTTCCAGCAGATCTGGAAGGG + Intergenic
1114875781 14:26716132-26716154 CTAGTTCAGCTGATCTGGGATGG - Intergenic
1115081009 14:29450555-29450577 CTAGTTCAGGAGAGCTGGAATGG + Intergenic
1115503583 14:34071873-34071895 CTTGTCCAGCAGATGGGTAAGGG - Intronic
1117712081 14:58541293-58541315 CTAGTGGAGCACATCTTTAATGG + Intronic
1120234588 14:81876025-81876047 CTAGGCCCCCAGATCTGTGATGG - Intergenic
1120659072 14:87230946-87230968 CTAGGCCACCAGGTCTGTGATGG + Intergenic
1121681218 14:95794179-95794201 CTAACACAGCAGATCTGAAATGG + Intergenic
1124692706 15:31838959-31838981 CCAGTCCATCGGATCTGTTATGG - Intronic
1126315084 15:47361568-47361590 CTAGACTAGCAGCTCTGTGAGGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1127861257 15:62996289-62996311 CTCATCCAGCAGATCTAGAATGG + Intergenic
1129512700 15:76136752-76136774 CTAGTCCAGCATCTCTGGACAGG + Intronic
1130025872 15:80270102-80270124 ATAGTTCAGCTGTTCTGTAATGG + Intergenic
1130196803 15:81787169-81787191 CTTCTTCAGCAGATGTGTAATGG - Intergenic
1131067942 15:89446007-89446029 CTAGCCCAGCACATCTGTGCAGG - Intergenic
1143938507 17:10512952-10512974 CTTCTCCAGAAGATCTGCAACGG + Exonic
1147522541 17:41188312-41188334 CTGGTCCAGCATATGGGTAATGG - Intergenic
1150782515 17:68134673-68134695 CTAGACCAGCCGAGCTGCAAGGG - Intergenic
1153692304 18:7606032-7606054 CTGGTCCTGCAGACCAGTAAAGG - Intronic
1155565142 18:27126366-27126388 CTAGACCATGAGATCTGTGATGG - Intronic
1159352250 18:67290933-67290955 CAAGGCCAGCAGATCTCTTAAGG - Intergenic
1160275757 18:77433412-77433434 CTACCCAAGCAGATCTGTAGTGG - Intergenic
1160487974 18:79310846-79310868 CCAGCCCAGCATTTCTGTAATGG - Intronic
926033549 2:9614854-9614876 CTAGTCTATCAGCTCTGTTATGG + Intronic
926938890 2:18114906-18114928 CTAGGCCTCCAGACCTGTAATGG - Intronic
931967167 2:67546650-67546672 CTAGGCCTCCAGATCTGTGATGG + Intergenic
932268028 2:70385151-70385173 CTAGTCCACCAGCTTTGTTAAGG + Intergenic
933454310 2:82502030-82502052 CTAGGCCTTCAGACCTGTAATGG - Intergenic
935724013 2:106007506-106007528 CTAGTCCTCTAGATCTGTGATGG - Intergenic
941796359 2:169603387-169603409 CTATACCAGCATATCAGTAAAGG + Intronic
942102840 2:172603059-172603081 CTGGTTCAGCAGATCTGGAGTGG + Intronic
942684506 2:178517447-178517469 CTAGTTCAGCAGATCTGGGATGG - Intergenic
942908022 2:181206770-181206792 CTAGGCCTCCAGGTCTGTAATGG + Intergenic
943004792 2:182376048-182376070 CTAGACCTCCAGGTCTGTAATGG + Intronic
947680632 2:232028923-232028945 CTATTCTAGAAGATCTCTAATGG + Intronic
1168994776 20:2124996-2125018 CAAGTCCTGCAGAGCTGCAAGGG - Intronic
1171943994 20:31359735-31359757 CTGATTCAGTAGATCTGTAATGG - Intergenic
1172982872 20:38957814-38957836 TTAGTACAGCAATTCTGTAAAGG + Intergenic
1173023703 20:39288503-39288525 CTTGTCCAGCATAGCTGGAAGGG + Intergenic
1182269022 22:29141800-29141822 CTAGTCCTTCAGATCTTTAGAGG + Intronic
1183321340 22:37166904-37166926 CGAGACCAGCAGACCTGCAAGGG + Intronic
1183722001 22:39568029-39568051 CTCTTCCAGCAGATCAGTCAGGG + Intergenic
949736591 3:7179368-7179390 CTACTACTGCACATCTGTAAAGG + Intronic
949798097 3:7872771-7872793 CTAGTGCTGAAGACCTGTAATGG - Intergenic
950540219 3:13607996-13608018 CAAGTCCAGCAGATATGCAGGGG - Intronic
951771188 3:26259360-26259382 CTAATTCAGCAGATCTGGGATGG - Intergenic
953688890 3:45100557-45100579 CTGATCCAGCAGATGTGAAAGGG - Intronic
954683949 3:52360520-52360542 CTAGTCCATCAGAGCAGTACAGG + Intronic
956645905 3:71455856-71455878 ATATTCCCGCAGATCTGCAATGG - Intronic
958518726 3:95156629-95156651 CTAGGCCTCCAGATCTGTGATGG + Intergenic
962158509 3:132974667-132974689 CTATTCCAGAATATCTGTAACGG + Intergenic
962935395 3:140076014-140076036 GTTGTACAGCAGATCTCTAATGG + Intronic
965383885 3:168022877-168022899 TCAGTCCAGCAGATCTGAAGGGG + Intronic
965515511 3:169617400-169617422 CTAGTTCAGTAGATCTGAGATGG + Intronic
967034578 3:185638683-185638705 CTAGAACAGCAGATCTTTGAAGG - Intergenic
967155030 3:186684164-186684186 CTAGGCCTCCAGATCTGTGATGG + Intergenic
968669652 4:1842256-1842278 CAAGTCCTGCAAATCAGTAAGGG + Intronic
970311083 4:14783210-14783232 ATAGTCCAGCGGGTCTGTAAGGG + Intergenic
975458816 4:74626576-74626598 CTAGTCCACCCTATCTGTGAAGG + Intergenic
976042764 4:80906831-80906853 CTAGTCCTCCAGAACTGTGATGG + Intronic
977197545 4:94081598-94081620 CTAGGCCTCCAGACCTGTAATGG + Intergenic
983409508 4:167379160-167379182 CCAGGCCACCAGATCTGTCATGG - Intergenic
984078292 4:175211168-175211190 TTAGTCCATGAGATCTGTGAGGG + Intergenic
984119538 4:175724991-175725013 TTAGTTCAGGAGATATGTAAGGG - Intronic
986924639 5:12731716-12731738 CTAGGCCTTCAGATCTGTGATGG + Intergenic
986949976 5:13071146-13071168 CTAGGCCTCCAGATCTGTGATGG + Intergenic
987216075 5:15738702-15738724 CTTTTCTAGCAGATCTGTAGGGG - Intronic
987737607 5:21866847-21866869 CTAGACCTCCAGATCTGTGATGG - Intronic
988138194 5:27201572-27201594 CTAGTCCTACAGACCTGTGATGG + Intergenic
988647252 5:33108253-33108275 CTAGGCCTCCAGAACTGTAATGG - Intergenic
988876920 5:35457149-35457171 CTAGCCCTCCAGATTTGTAATGG - Intergenic
991911442 5:71566450-71566472 CTACCCAAGCAGATCTGTAGTGG + Exonic
998010652 5:138692901-138692923 CTAGTCTAGCAGATTTGAAGAGG - Intronic
998100585 5:139430363-139430385 CTAATCCAGCAGTTCTCAAAGGG - Intronic
999107974 5:149090812-149090834 CTAGACCTGCAGGTCTGTGATGG - Intergenic
999918222 5:156287259-156287281 CTTATTCAGCAGATCTGGAAGGG + Intronic
1000675518 5:164117889-164117911 TTATTTCAGCAGAACTGTAATGG - Intergenic
1005016780 6:21382057-21382079 CTAGTCTAGCAGATCCCAAATGG - Intergenic
1007403545 6:41618598-41618620 CTAGTGCAGCCTATCTGCAACGG + Intergenic
1009383584 6:63062926-63062948 CTAGACCTCCAGACCTGTAATGG - Intergenic
1011294129 6:85808461-85808483 CTAGGCCTCCAGATCTGTGATGG + Intergenic
1012566412 6:100660662-100660684 CTAGTGCAGAAGATCTGTGTTGG - Intronic
1017070799 6:150574019-150574041 ATATTACAGCAGATTTGTAAAGG - Intergenic
1018942894 6:168321015-168321037 TTAGTCCAGCAGATGTGAAGTGG + Intergenic
1022324854 7:29321917-29321939 CTAATCCATAAGATCTGCAAAGG - Intronic
1022702943 7:32778440-32778462 CTTGTCCAGCAGACATGTCAGGG + Intergenic
1022907177 7:34868560-34868582 CTTGTCCAGCAGACATGTCAGGG + Intronic
1023681386 7:42691133-42691155 CCATTCCAGCTGATGTGTAATGG - Intergenic
1026428388 7:70319339-70319361 ATAGACCTGCAGATCTGAAATGG - Intronic
1028784194 7:94773696-94773718 CTAGTCTTCCAGGTCTGTAATGG - Intergenic
1031831056 7:126626145-126626167 CTAGTACAGCAAATTTGAAAAGG - Intronic
1032474964 7:132205314-132205336 CCAGTCCGGCAGATCTGGGATGG - Intronic
1033730194 7:144171055-144171077 CTAGGCCACCAGACCTGTGATGG - Intergenic
1035052432 7:156007089-156007111 TTTGTCCAGCAGATCTGCATTGG + Intergenic
1039330124 8:36528460-36528482 CTAGTACAGTAAATCTGAAATGG + Intergenic
1041511374 8:58658784-58658806 CAGGTCCAGCATATCTGAAAGGG + Intronic
1041820617 8:62028360-62028382 TTTGCCCAGGAGATCTGTAATGG + Intergenic
1042664572 8:71191555-71191577 CTCTTCCAGGAGATCTGTGAAGG + Intergenic
1043561607 8:81500086-81500108 CTAGGCCTCCAGATCTCTAAAGG - Intergenic
1043838291 8:85069421-85069443 CTAGACCAGCAGTTCTCAAAGGG + Intergenic
1044395521 8:91706263-91706285 CCAGTGCAGCACTTCTGTAAAGG - Intergenic
1044557426 8:93578953-93578975 TTAGTCCAACAGATGTGTGATGG - Intergenic
1045001566 8:97882823-97882845 CTATTCCAGCAGATTTGTTGTGG + Intronic
1046334140 8:112760810-112760832 ATAGCCCAGCAGATCTGCAAGGG + Intronic
1048934690 8:139345067-139345089 CAAGCCCACCAGTTCTGTAAGGG - Intergenic
1052768718 9:32668118-32668140 CTATTTCAGTAGATCTGGAATGG - Intergenic
1059698136 9:116748264-116748286 CTGGCCCTGCAGATCTGTTAAGG - Intronic
1188115024 X:26232139-26232161 CTAGGCCTCCAGATCTGTGATGG + Intergenic
1189707846 X:43777499-43777521 CAAGTACAGAAGATCTGCAATGG + Intronic
1192345533 X:70300996-70301018 CTAGGCAAGTAGATGTGTAAAGG + Intronic
1192790542 X:74378295-74378317 CTAGTACAGGAGCTCTTTAAGGG + Intergenic
1193773107 X:85611005-85611027 CTAGTACAGCAGGTTTTTAAAGG - Intergenic
1194841764 X:98752409-98752431 CTAGGCCTCCAGACCTGTAATGG + Intergenic
1198956215 X:142134699-142134721 CTAGGCCTCCAGGTCTGTAATGG - Intergenic
1199043187 X:143138901-143138923 ATAGGCCTGCAGATCTGTGATGG - Intergenic
1200174763 X:154106361-154106383 CTAATCCAGGAGAGCTGTGATGG + Intergenic