ID: 1088080531

View in Genome Browser
Species Human (GRCh38)
Location 11:105906601-105906623
Sequence AGAAGATGGAAATCTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088080531_1088080537 18 Left 1088080531 11:105906601-105906623 CCATCTCTAGATTTCCATCTTCT 0: 1
1: 0
2: 4
3: 47
4: 434
Right 1088080537 11:105906642-105906664 GCAGGCTGCCAGCTAATACGTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1088080531_1088080534 0 Left 1088080531 11:105906601-105906623 CCATCTCTAGATTTCCATCTTCT 0: 1
1: 0
2: 4
3: 47
4: 434
Right 1088080534 11:105906624-105906646 TAATGGCATAGCCCTCGTGCAGG 0: 1
1: 0
2: 0
3: 1
4: 27
1088080531_1088080539 26 Left 1088080531 11:105906601-105906623 CCATCTCTAGATTTCCATCTTCT 0: 1
1: 0
2: 4
3: 47
4: 434
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088080531 Original CRISPR AGAAGATGGAAATCTAGAGA TGG (reversed) Intronic
900699109 1:4033001-4033023 AGAAGAGGGAGATCTGGAGAGGG + Intergenic
901576669 1:10206669-10206691 GGAAGATGGAAATGTTGAGTTGG - Intergenic
903205646 1:21780682-21780704 AGAATAGGGAAATTTAGAGGCGG + Intronic
903280724 1:22248419-22248441 AGAAGATGGAATCCCAGAGCTGG - Intergenic
903591450 1:24458988-24459010 AGAAGACAGAAATCTAGCAATGG - Intronic
903823127 1:26118764-26118786 ACTAGATGTAAATTTAGAGAGGG - Intronic
905101173 1:35523301-35523323 AGAAGATGGAAAACCAAACATGG - Intronic
906204013 1:43977337-43977359 AGAAGATGGAAATGAGGAGGTGG - Intronic
906283066 1:44567007-44567029 AGAAGAGGAAAAGCTAGAGATGG + Intronic
906951905 1:50341507-50341529 ACAAGATGGAAAATTAGAGGTGG - Intergenic
907486289 1:54780558-54780580 AGAAGAGGGAAATCAAGTGAAGG + Exonic
908256125 1:62305001-62305023 GGAATATTGTAATCTAGAGAGGG + Intronic
908262416 1:62349434-62349456 AGAAGAGGGAAAGGGAGAGAAGG + Intergenic
909306072 1:74079010-74079032 AGTAGCTGAAAATTTAGAGAAGG - Intronic
909671670 1:78196081-78196103 AGAATAGGGAAATTTAGACATGG - Intergenic
909679710 1:78278214-78278236 AGAAGATGGAGAGGTAGACAGGG + Intergenic
910204585 1:84735505-84735527 AGCAGTTGGAGAGCTAGAGAAGG + Intergenic
911330348 1:96519407-96519429 AGAAAATTGAAACCCAGAGAGGG - Intergenic
911467645 1:98275300-98275322 AGAACATGGAAATGTGGAGGGGG + Intergenic
911851717 1:102828793-102828815 AGAAAATGGAAATCAAAAAAAGG + Intergenic
912988140 1:114455599-114455621 GGAAGATGGAAATCTACAGATGG + Intronic
913409869 1:118539600-118539622 AGAAGCTGGAAAACTTGAAAAGG + Intergenic
913612770 1:120524346-120524368 AGAAGAGGAGAATCCAGAGATGG + Intergenic
914578421 1:148997901-148997923 AGAAGAGGAGAATCCAGAGATGG - Intronic
914750348 1:150530804-150530826 AAAAGCTGGATATCTATAGATGG - Intergenic
915655069 1:157352698-157352720 AGTAGATGGAGATCCAGTGAGGG + Intergenic
915839334 1:159202381-159202403 AGAGGAGGGAAATCCAGGGAAGG - Intronic
917264270 1:173203232-173203254 AGAAAACAGAAACCTAGAGAGGG - Intronic
917472996 1:175342090-175342112 AAAAGATGGGAATATAAAGAAGG + Intronic
918997997 1:191787652-191787674 ATAATATGGAAATGTACAGAAGG - Intergenic
919319281 1:196014381-196014403 AGAAGATGGATAACTAGATGAGG + Intergenic
919858526 1:201722196-201722218 AGAAGACAGAATTCTGGAGATGG - Intronic
919930826 1:202220572-202220594 AGAAAATGGAGACTTAGAGATGG + Intronic
920022860 1:202968387-202968409 ATAAGATGGATATCTACAGATGG + Intergenic
920281643 1:204847942-204847964 AGAAGATGGATATAAAGAGAGGG + Intronic
921140638 1:212302788-212302810 AGAATAGGGAAATCTAGAGACGG - Intronic
921329536 1:214021707-214021729 AGAAGCTGGAATTCTTGAGTTGG + Intronic
921708786 1:218352752-218352774 AAAAGAAGGCAATTTAGAGATGG - Intronic
922072161 1:222205125-222205147 AGAACAGTGAAAACTAGAGAAGG + Intergenic
922443017 1:225672222-225672244 AGGAAATGGAGGTCTAGAGAGGG - Intergenic
922682132 1:227608788-227608810 AGGAAAAGTAAATCTAGAGAAGG + Intronic
923220210 1:231886026-231886048 AGAAGGTGGAAAGGCAGAGAGGG + Intronic
923548358 1:234941323-234941345 AGAAGAGGGTAATGTGGAGATGG - Intergenic
1063413813 10:5857181-5857203 AGAAAATTGAAATTTAGGGATGG - Intergenic
1063436859 10:6039616-6039638 GGAAAATGGAAGTCTAGATAAGG + Intronic
1063843854 10:10103236-10103258 AGACCATGGAAATTTAGACAAGG + Intergenic
1064514959 10:16137176-16137198 AAAAGATGGAAATCTTGCCATGG + Intergenic
1065489030 10:26264294-26264316 AAAAGCTTGAAATCTGGAGATGG - Intronic
1067529403 10:47059598-47059620 AGGAGATGGAGAACTGGAGAAGG + Intergenic
1068052734 10:51972621-51972643 AGCAGATGAAAATGTAGATAAGG - Intronic
1068949374 10:62761920-62761942 AGAAGAGGTAAATCTTGATATGG + Intergenic
1069219108 10:65861142-65861164 AGAAGATGGGAAGCTAGAGGAGG - Intergenic
1072783488 10:98265840-98265862 AAAAGGGGCAAATCTAGAGAAGG - Intronic
1073423965 10:103445153-103445175 AGCAGATGGACACCCAGAGATGG - Intronic
1074112448 10:110432105-110432127 AGAAGATGGGAGAGTAGAGATGG + Intergenic
1075293866 10:121255075-121255097 AGAGGCTGGTAATCTAGAAATGG + Intergenic
1075687064 10:124371569-124371591 GGAAGATGGAAAAGCAGAGAGGG + Intergenic
1077426415 11:2480894-2480916 AAAAGAGGGAAGTCTGGAGAGGG + Intronic
1077640760 11:3879368-3879390 AGAAGATTATAATCTAGAAAGGG - Intronic
1077820399 11:5732270-5732292 AGAAGTTGGAAGTTTAGAGTTGG - Intronic
1078156711 11:8806071-8806093 AGCAGGTGGTAATCGAGAGAAGG - Intronic
1078967251 11:16360328-16360350 AGAGTCTGGAAATGTAGAGATGG - Intronic
1079273546 11:19012330-19012352 AGAAGAAAGAAATTTAGAGATGG - Intergenic
1079792327 11:24754067-24754089 ACAAGGTGGAAATCTTTAGATGG - Intronic
1079926133 11:26493841-26493863 AGAAGAAGGAAATCCTCAGAGGG - Intronic
1082273491 11:50197594-50197616 AGCAAATGGAAATCTAAAAAAGG - Intergenic
1083762033 11:64823980-64824002 AGAAGAAGGGAAGATAGAGAAGG - Exonic
1084780287 11:71403771-71403793 AGAAGATGGAGGCCCAGAGAAGG - Intergenic
1084919188 11:72455333-72455355 ACAAGATGGAATGCTAGAGTGGG + Intergenic
1085235158 11:75008960-75008982 AGAGGAGGGCAATTTAGAGATGG - Exonic
1085440993 11:76562130-76562152 TCAAGAGGGAAATCTTGAGAGGG - Intergenic
1085653452 11:78290169-78290191 AGAAGATGGCAATCTAAATTAGG + Intronic
1087000925 11:93419792-93419814 AGAAAATGGAAAACATGAGAAGG - Intronic
1087546523 11:99591256-99591278 AGAAGAGGTAAATCATGAGATGG - Intronic
1087592753 11:100212644-100212666 TGAAGATGGAGACCTAGACAAGG - Intronic
1087732510 11:101794949-101794971 AGAAAATGACAATCTAGATAAGG - Intronic
1087977617 11:104569245-104569267 ACAAGATGGAAAACCAGAGTGGG + Intergenic
1088075151 11:105839076-105839098 AGTAGAGGGAAAGCTAGAGGGGG - Intronic
1088080531 11:105906601-105906623 AGAAGATGGAAATCTAGAGATGG - Intronic
1088736508 11:112732167-112732189 AGAGGATGGGTAACTAGAGATGG - Intergenic
1088868823 11:113874783-113874805 AGAAGATTGAAATCAATATAAGG - Intronic
1089243495 11:117100847-117100869 AGAATATAGAAAATTAGAGAAGG + Intergenic
1089869508 11:121659576-121659598 AAAAGAAAGAATTCTAGAGAAGG - Intergenic
1090136231 11:124201639-124201661 AAAAAATTGAAATCAAGAGATGG + Intergenic
1091619822 12:2078240-2078262 AGCAGATGGATTTCTAGTGAGGG - Intronic
1091692796 12:2608568-2608590 AGAAGATGGAGATCTCCACACGG - Exonic
1092100217 12:5877239-5877261 AGAAGAAGGCAATGTAAAGATGG + Intronic
1092999043 12:13978422-13978444 AAAAGAATGAAACCTAGAGAAGG + Intronic
1094235871 12:28165415-28165437 AGAACATGTAAAACTAGAAATGG + Intronic
1094681249 12:32669198-32669220 AAAAGAAGGAAATCTGGATATGG + Intergenic
1095090454 12:38099562-38099584 AGAAGGTGGAAGAGTAGAGATGG - Intergenic
1096273641 12:50187125-50187147 AGTAGATGGTAATCAACAGAGGG - Intronic
1097734013 12:63162245-63162267 AGAAGATGAAAATATGAAGATGG + Intergenic
1097975123 12:65677360-65677382 AGATGATGCAAATATAGACACGG - Intergenic
1098544812 12:71700019-71700041 AGAGGTTGGAAGGCTAGAGAAGG + Intronic
1098564753 12:71920749-71920771 AGAAGATGGAAATTTGTACATGG - Exonic
1098727393 12:73984885-73984907 AGGAGAAAGAAAACTAGAGATGG - Intergenic
1099148287 12:79075786-79075808 TGAAGATAGAAATCCTGAGAGGG - Intronic
1100183974 12:92117633-92117655 AGAATATGAAAAAATAGAGATGG + Intronic
1100291590 12:93220195-93220217 AGAGGAGGGAAATAAAGAGAAGG + Intergenic
1101041357 12:100759114-100759136 AGGATATGGAAACCTAGAGATGG + Intronic
1101809003 12:108091714-108091736 AAGAAATGGAAATCTAGGGAAGG + Intergenic
1103173467 12:118842560-118842582 GGAAGATGGAAAGATAAAGAGGG + Intergenic
1103535294 12:121629760-121629782 TGAAGTTGGAAATCTATAGGAGG + Intronic
1103900638 12:124302075-124302097 AGAAGAGGGAAATCTGGACATGG - Intronic
1108093135 13:46871857-46871879 AGAAAATGGAATTATAGAGCTGG + Intronic
1108108679 13:47043506-47043528 AGAAGATGCAAAGCCAGAGAAGG - Intergenic
1109639531 13:65171437-65171459 AGAAAATGAAAATCAAGATAAGG + Intergenic
1109729702 13:66395993-66396015 AGAAGATTTAAATCTATTGAAGG + Intronic
1109959499 13:69612562-69612584 AGAAGAAAGAAATCTAGTGAGGG + Intergenic
1109994257 13:70102692-70102714 AGAAGACTGAAATATAAAGAGGG - Intronic
1110286953 13:73760848-73760870 AGAAAGTGAAAATCTAAAGATGG + Intronic
1110840880 13:80141556-80141578 AGAAGAAGGAAATCTAAATAAGG + Intergenic
1111307698 13:86436219-86436241 TGCAGATGTAAATGTAGAGAAGG - Intergenic
1111499257 13:89094091-89094113 AGAAAAAGGAAATATAGAAAGGG + Intergenic
1111884825 13:94006934-94006956 AGAAAATGGAAAACATGAGAAGG - Intronic
1112113154 13:96324718-96324740 AGAAGATGTGAAGCTAAAGAGGG + Intronic
1112127353 13:96482716-96482738 ATAAGATAGAAATCTACGGAAGG + Intronic
1112597684 13:100823532-100823554 AGAAAATGGAACTCTGGAAAAGG - Intergenic
1113599614 13:111559211-111559233 AGAGGATGGAAATGTAGAGAGGG + Intergenic
1114886282 14:26855790-26855812 AAAAGATTTAAATGTAGAGAGGG + Intergenic
1115797037 14:36949714-36949736 AGAAAATAGGAATCTAGAAATGG - Intronic
1116626818 14:47275932-47275954 AGACAATGGGAATGTAGAGATGG - Intronic
1117096395 14:52303030-52303052 AGAGGCTGGAAATCCAGTGAGGG + Intergenic
1117331976 14:54721714-54721736 AGACAATGGAAACCGAGAGAAGG - Intronic
1117571533 14:57053970-57053992 AGAAAATGGAAAGCTACTGAAGG - Intergenic
1117739666 14:58804018-58804040 AGAAAGTTGAAACCTAGAGAAGG - Intergenic
1118135094 14:63015392-63015414 TGATGAAGGATATCTAGAGAGGG + Intronic
1118164010 14:63318052-63318074 GGAGGATGGGCATCTAGAGAGGG - Intronic
1118602844 14:67482534-67482556 AGAACATGGAACTGTAGTGATGG - Intronic
1118638540 14:67770587-67770609 AGAATATGGATGTATAGAGAAGG - Intronic
1119343653 14:73903049-73903071 AGAAGATGGAAATCTAAAAATGG + Intronic
1120174524 14:81278698-81278720 AGAAGATGAAGAAGTAGAGATGG - Exonic
1121918759 14:97860730-97860752 AGAAGATGGGAATTTGGACATGG + Intergenic
1121981425 14:98457755-98457777 AGAAGGTAGAAAGGTAGAGAAGG - Intergenic
1122026227 14:98879403-98879425 GGAAGCTGGAACTCAAGAGAAGG - Intergenic
1122101857 14:99418766-99418788 AGAAGATGGACATCCCCAGAAGG + Intronic
1122201156 14:100123581-100123603 ATGAGATGGACATCCAGAGAAGG + Exonic
1124243041 15:28046912-28046934 ACAAGAGGGAAATCTTGAGCAGG - Intronic
1124462758 15:29908091-29908113 AGAAGAAGGAAAGATAAAGAGGG + Intronic
1124491034 15:30155736-30155758 ACAAGCTGGAAATATAGAGTAGG + Intergenic
1124752503 15:32382595-32382617 ACAAGCTGGAAATATAGAGTAGG - Intergenic
1124791248 15:32729432-32729454 AGAAGAGGGAAAGGTGGAGAAGG - Intronic
1125160772 15:36641092-36641114 ACAAGATGGAACACTTGAGAGGG - Intronic
1125174916 15:36809923-36809945 AGAAGATGAAATGCTAAAGAAGG + Exonic
1125175666 15:36818653-36818675 CGAACATTGAAATCTGGAGAGGG + Intergenic
1125209650 15:37198180-37198202 AGGAGATGGACATCTTTAGAGGG + Intergenic
1125271050 15:37939127-37939149 CAAAGATGTAATTCTAGAGAAGG - Intronic
1126145139 15:45466798-45466820 AGAAGATGGAAGGTTAGAAATGG + Intergenic
1126813037 15:52427824-52427846 AAAAGAAGGAAAGCTGGAGAAGG + Intronic
1128106880 15:65051663-65051685 CCCAGAGGGAAATCTAGAGAGGG + Intronic
1128680767 15:69649711-69649733 GTAAGATGGAAATCAGGAGAGGG - Intergenic
1131011563 15:89022259-89022281 AGAAGATAGCAATCTAGGGTGGG + Intergenic
1131524437 15:93141741-93141763 GGAAGAGGGCAATCTAGAGAGGG + Intergenic
1133101115 16:3480614-3480636 AGAAGAAGAAAAGTTAGAGAAGG + Intronic
1133597581 16:7308138-7308160 AGGACACAGAAATCTAGAGATGG + Intronic
1134492077 16:14703062-14703084 AGAAGATGGAGAGATGGAGATGG - Intergenic
1134497458 16:14742184-14742206 AGAAGATGGAGAGATGGAGATGG - Intronic
1135024656 16:18989745-18989767 ACAAGATGGTAAGATAGAGAAGG + Intronic
1135315418 16:21440811-21440833 ACAAGATGGTAAGATAGAGAAGG - Intronic
1135368344 16:21873079-21873101 ACAAGATGGTAAGATAGAGAAGG - Intronic
1135375943 16:21947572-21947594 AGAAGAAAGAAATCAACAGAGGG + Intergenic
1135443473 16:22498070-22498092 ACAAGATGGTAAGATAGAGAAGG + Intronic
1135449271 16:22543534-22543556 ACAAGATGGTAAGATAGAGAAGG + Intergenic
1136153143 16:28365148-28365170 AGAAGATGGAGAGGTGGAGATGG + Intergenic
1136209942 16:28750125-28750147 AGAAGATGGAGAGGTGGAGATGG - Intergenic
1136312088 16:29419471-29419493 ACAAGATGGTAAGATAGAGAAGG - Intergenic
1136325527 16:29521267-29521289 ACAAGATGGTAAGATAGAGAAGG - Intergenic
1136440216 16:30261249-30261271 ACAAGATGGTAAGATAGAGAAGG - Intergenic
1137821297 16:51448749-51448771 AGGAGATGGAAATTTAAAAAAGG - Intergenic
1139232551 16:65298147-65298169 AGAACATGGAAACACAGAGATGG + Intergenic
1139325145 16:66146758-66146780 AGTAGACTGAAATCCAGAGAGGG + Intergenic
1139886714 16:70213532-70213554 ACAAGATGGTAAGATAGAGAAGG - Intergenic
1140953903 16:79844989-79845011 AGAATATGGGAATCCAGAAATGG + Intergenic
1142649366 17:1337214-1337236 AGAAAAAGAAAATATAGAGATGG + Intergenic
1143356315 17:6331352-6331374 GGAAGATGGAGGTCTAGAGCTGG - Intergenic
1143910001 17:10240104-10240126 AGAATATGGAAATGGAGAGTAGG + Intergenic
1144143315 17:12371263-12371285 AGAAGAGGGAATTGGAGAGAAGG - Intergenic
1144657392 17:17045453-17045475 AGAAGATTGAAACCCAGAGAAGG + Intronic
1146027216 17:29331915-29331937 AGAAGGAGGAAATGGAGAGAAGG - Intergenic
1146599753 17:34204454-34204476 AGAAGTTGGACAGCTAGAGAAGG + Intergenic
1146617615 17:34369513-34369535 AGAATATGGGGATCTAGAGCGGG - Intergenic
1146754744 17:35419589-35419611 AGAAGAAGGAGGTCAAGAGAAGG + Intronic
1148391109 17:47273759-47273781 AGAACATGGAATTTTAGAGTTGG - Intronic
1148723468 17:49771821-49771843 AGAAGAAAGAAATCTAAAGTGGG - Intronic
1149030322 17:52075423-52075445 AGATCATGTAAATCAAGAGAAGG - Intronic
1149872529 17:60195914-60195936 GGAAGAAGGAAAACTGGAGAAGG - Intronic
1150121575 17:62607733-62607755 AGAAAAGGGAGATCTAGAGCAGG - Intronic
1150176679 17:63064627-63064649 AAAAGATGGAAATATATAAAAGG - Intronic
1150562743 17:66308353-66308375 AGGAGATGGAAATCTAAAAGAGG - Intronic
1150646375 17:66980240-66980262 AGGAGATGGATTTCTAGGGATGG - Intronic
1151144174 17:72024405-72024427 AGAAGAGGGCAATTTAGGGAAGG + Intergenic
1152092159 17:78252967-78252989 AGTTGATGGGAGTCTAGAGAGGG - Intergenic
1152416284 17:80164558-80164580 AGAACAGGCAAATCCAGAGATGG + Intergenic
1153417283 18:4860686-4860708 AGAACATGGAAATATACACATGG + Intergenic
1153863790 18:9242976-9242998 AGAAAATTGAAATTTAGAAATGG + Intronic
1155304360 18:24464590-24464612 AGAAAATGGCAATCAAAAGATGG - Intronic
1155729117 18:29130147-29130169 AGAATATCCAAAACTAGAGAGGG + Intergenic
1155867564 18:30984570-30984592 AGAAGATGAAAAGGAAGAGAAGG + Intergenic
1156074826 18:33261423-33261445 AGAAGATGTAAATCAATAGAGGG - Intronic
1156734266 18:40234290-40234312 AGAAGCTGGAAAAATACAGATGG - Intergenic
1157474453 18:48012370-48012392 AGAGGCTGGGAATCTAGAGGGGG + Intergenic
1157905456 18:51565510-51565532 AGAAGATGTAAACCATGAGAGGG - Intergenic
1158584453 18:58719020-58719042 AGAAGGTAGAAAACTAGGGAAGG + Intronic
1158667308 18:59444056-59444078 AAAAGATGGAAATTTTGACACGG - Intronic
1159520727 18:69518299-69518321 AGAAGAAGGAAAAAAAGAGAAGG - Intronic
1161554020 19:4930401-4930423 AGAAGCTGGAAATCCAGGCAGGG - Intronic
1163383140 19:16981763-16981785 AGAAGAGGGATATCTGGAGTAGG + Intronic
1164399892 19:27895245-27895267 CCAAGAAGGAAACCTAGAGAAGG - Intergenic
1164574209 19:29396241-29396263 AGAGGGTGGAAATCTACTGAAGG + Intergenic
1164778553 19:30873537-30873559 AAAAGATGGAAATCTTTAGCAGG + Intergenic
1165983723 19:39748844-39748866 AGAAGAATGAGATCAAGAGATGG - Intergenic
1167427761 19:49438205-49438227 AAGAGATGGAAACCTAGAGAAGG + Intronic
1168072160 19:53959352-53959374 AGAAGAGAGAGATCCAGAGAGGG - Intergenic
1168083812 19:54030104-54030126 AGAAGCTGGAAATGTACTGACGG + Intergenic
924981412 2:225463-225485 AGGAGCTGGAGATCTGGAGATGG + Intronic
925668965 2:6291239-6291261 AGAAAATGGAGATTTAGGGAAGG - Intergenic
925718296 2:6804908-6804930 GGAATAATGAAATCTAGAGAGGG - Intergenic
927586507 2:24311540-24311562 AGAATATAGAATTCTAGAGCTGG - Intronic
928163298 2:28949885-28949907 AGAAGATGGCAACCTACAGGTGG + Intergenic
928844598 2:35655792-35655814 AGAAGATGGAAACATTAAGAAGG - Intergenic
929465717 2:42141881-42141903 AGAAGCTGGAAGCCGAGAGAGGG - Intergenic
930139746 2:47939307-47939329 AAAAGAAGGAAATCCAGAAAGGG - Intergenic
930389537 2:50743695-50743717 AGAAGATGGGACTGTAGTGAGGG - Intronic
930949004 2:57114411-57114433 AGAAGATAGAAATCAAGATAGGG - Intergenic
933134437 2:78714564-78714586 AGAATATGGTAAAATAGAGAAGG + Intergenic
933188393 2:79304310-79304332 AGTACATGTAACTCTAGAGAAGG + Intronic
933635430 2:84703210-84703232 AGATAATGGAACTCTAGAAATGG - Intronic
934069962 2:88374675-88374697 AGAAGATGGAAGAAGAGAGAAGG + Intergenic
936170298 2:110165518-110165540 AGAAGAAAATAATCTAGAGATGG + Intronic
939665303 2:144944451-144944473 GGAACAAGGAAAGCTAGAGAAGG - Intergenic
939883391 2:147655436-147655458 AGAATATGGAAATCTAAAATGGG - Intergenic
939998604 2:148944264-148944286 AGAAGATAAAGTTCTAGAGATGG - Intronic
941291365 2:163679584-163679606 AGAAGATGGAAAGTTAGACCAGG - Intronic
941523346 2:166576592-166576614 AAAAGGTGGAAATGTACAGATGG - Intergenic
941801671 2:169666316-169666338 AGAAGCTCGAATTCTAGTGAGGG + Intronic
941801682 2:169666536-169666558 AGAAGCTCGAATTCTAGTGAAGG - Intronic
942662237 2:178278071-178278093 AGTATATGAAAATCAAGAGACGG - Intronic
943050641 2:182909345-182909367 AGGAGAGGGAAATGAAGAGAAGG - Intronic
944115262 2:196179034-196179056 TGAGGATGGAAATATACAGATGG + Intergenic
946181967 2:217954253-217954275 ACAAGATGGAGACCCAGAGAGGG - Intronic
946439602 2:219684319-219684341 AAAAGATGGAAATCCAGTGAAGG + Intergenic
946632373 2:221684229-221684251 AAAAGATGAAACTTTAGAGATGG + Intergenic
947561571 2:231158337-231158359 AGTAGAGAAAAATCTAGAGAGGG + Intronic
947571904 2:231242767-231242789 AGAAGATGGGAATGTAAGGATGG - Intronic
948332345 2:237179763-237179785 GGAAGATGGAAAACTAGAAGGGG + Intergenic
1169186641 20:3623065-3623087 AAAAGATTGAAATCCAGACAGGG + Intronic
1169507245 20:6224703-6224725 AGAAGATGGCAATCAAGAATTGG - Intergenic
1169978266 20:11354813-11354835 AGAAAATGGAGGCCTAGAGAGGG + Intergenic
1170359990 20:15535724-15535746 GGAAGATGGAAACCCAGAGGTGG - Intronic
1171390615 20:24799384-24799406 AAAACAAGGAAATGTAGAGATGG + Intergenic
1172361967 20:34319118-34319140 AGAAGATGTAAATCAATAAATGG + Intergenic
1173178027 20:40779606-40779628 AAAAGAAGAAAATCTACAGATGG - Intergenic
1173774489 20:45692976-45692998 TGATGATGGTAATGTAGAGATGG + Intronic
1174403581 20:50289558-50289580 AGAAGCTGTAAATCTAGATCGGG + Intergenic
1175656909 20:60779000-60779022 AGAAGTTGGAAGTCAAGAGTTGG - Intergenic
1178401897 21:32293611-32293633 AGAAGGGAGAAATCTAGAGAGGG - Intronic
1178446458 21:32647993-32648015 AGAAGAGGGAAGTCTTAAGATGG + Intronic
1178806754 21:35845798-35845820 AGAAGGAGGAAAACTAGAGAGGG - Intronic
1182070603 22:27461071-27461093 AGAAAATAGAAGTCCAGAGAGGG - Intergenic
1182788156 22:32925242-32925264 AGAAGAGGGAAATTTAGACACGG - Intronic
1183373531 22:37449200-37449222 AGGAGACTGAGATCTAGAGAAGG + Intergenic
1185054041 22:48568824-48568846 AGTGGAAGGAGATCTAGAGAAGG - Intronic
1185268969 22:49919477-49919499 AGAAGCTGGAAGGCCAGAGAGGG - Intronic
950117620 3:10461715-10461737 AGAGGAAGGAAGCCTAGAGATGG - Intronic
950555520 3:13693522-13693544 AGAAGATGGGAGGGTAGAGAGGG - Intergenic
951338043 3:21448237-21448259 AGAGGATGGAAGTATAGAAAAGG + Intronic
951796580 3:26545496-26545518 AAAAGATGGAGATCAAGGGAGGG + Intergenic
954879760 3:53825506-53825528 AGAATCTGGAAATATAAAGAGGG + Intronic
954882456 3:53845391-53845413 AGAAGACGGAGGCCTAGAGAGGG - Intronic
954958289 3:54541350-54541372 AGAAGATGGTCATATAAAGATGG + Intronic
955233680 3:57121586-57121608 AGAAGGAGGAAAGCTGGAGAAGG - Intronic
955558838 3:60166770-60166792 AGAAAATGGAAATCTAGTTAGGG - Intronic
955595124 3:60581257-60581279 AGAAAATGGAGATTTAAAGAGGG + Intronic
956178365 3:66495633-66495655 AGGAGAGGGAAATCTAGAAGAGG - Intronic
956606753 3:71080847-71080869 AGAAGAAGGAAATTCAGAGATGG - Intronic
956609608 3:71109296-71109318 AGAAAATGGAAAGTTAGAGGAGG - Intronic
956667439 3:71655300-71655322 GGAAGATGGAACTCCACAGAAGG - Intergenic
957783649 3:84850942-84850964 TGAACATGGAAATTTACAGAGGG - Intergenic
958080844 3:88744176-88744198 ACAAGCTGGAAACCCAGAGATGG + Intergenic
958153802 3:89727568-89727590 ACAAGATGGCAAGATAGAGATGG + Intergenic
958648111 3:96899243-96899265 GGAAGATGGACATGTAAAGATGG - Intronic
959284268 3:104387748-104387770 AGAAATTGGAGATCTAGAGAAGG - Intergenic
959479275 3:106851763-106851785 AGATAATGGAAAACTAGAGGGGG + Intergenic
959729184 3:109581588-109581610 AGGAGATGGAACTATAGAAAGGG - Intergenic
961096508 3:124161016-124161038 AGATGATGAAGTTCTAGAGATGG + Intronic
961550300 3:127667094-127667116 AGAAGATGGGTACCTGGAGATGG - Intronic
961597239 3:128028179-128028201 AGAAAGTGAAAAACTAGAGAGGG + Intergenic
962090820 3:132242386-132242408 AAAAAATGGAAATCAACAGATGG + Intronic
962552737 3:136511645-136511667 GGAGGATGGAAGTCTAGAGGAGG + Intronic
963652335 3:147995815-147995837 AGAAGATTGTAATCTAGTGGTGG + Intergenic
963654903 3:148034717-148034739 AGAAACTGGAAATCCAGAGTAGG + Intergenic
964493749 3:157266310-157266332 TGAAGATGGGAATACAGAGAGGG - Intronic
964821184 3:160771787-160771809 ACCAGATGGGAATATAGAGATGG + Intronic
965087490 3:164117676-164117698 AGTAGATGCAGATCTTGAGATGG - Intergenic
965244741 3:166252865-166252887 AGAAGATGGCAATCAGCAGAAGG - Intergenic
965765900 3:172129651-172129673 AGAAGCTGGAAATAAACAGAAGG - Intronic
965780058 3:172276063-172276085 AGAAGATAGAAATGTTTAGATGG + Intronic
965991305 3:174821886-174821908 AGAAGAAGGACAGCTAGGGAGGG + Intronic
967124785 3:186413784-186413806 AGGAGATGGGAAGCTAGAGGGGG + Intergenic
967358803 3:188606125-188606147 TGGAGGTGAAAATCTAGAGAAGG - Intronic
967489192 3:190069682-190069704 AATAGAAGGAAATCTAGCGAGGG + Intronic
968827920 4:2913298-2913320 ACATGATGGCACTCTAGAGATGG - Intronic
968975593 4:3820703-3820725 AGCAGATGGAAATGTTGGGAAGG - Intergenic
969243440 4:5916939-5916961 AGAGGGTGGAAATCCAGAGCTGG + Intronic
971020574 4:22530945-22530967 AGGAGAAGGAAATGCAGAGATGG + Intergenic
971353328 4:25872087-25872109 AGAAGATGGAAATTTGGGGCCGG + Intronic
971353372 4:25872417-25872439 AGAAGATGGAAATGTGGACATGG + Intronic
971416487 4:26436555-26436577 AGGAGATGAAAAGCTAGAAATGG - Intergenic
971416667 4:26438258-26438280 AGAAGACTGCAAGCTAGAGATGG - Intergenic
971635893 4:29057232-29057254 AGAAAATGAAAATAAAGAGAAGG - Intergenic
972279992 4:37592501-37592523 AGAAGGCTGAAATCCAGAGAGGG - Intronic
972582048 4:40403702-40403724 AGAAAATGGAAGCCCAGAGAAGG + Intergenic
973614552 4:52665557-52665579 GGAAGAGGCAAATCTGGAGAAGG - Intergenic
973657776 4:53067616-53067638 AGAAGAATGAAACCAAGAGAAGG - Intronic
974234107 4:59158989-59159011 ATAAGAGGGAAATCAAAAGAAGG - Intergenic
975406164 4:73993098-73993120 AGAAGAAGGAAAAGGAGAGAAGG + Intergenic
975904809 4:79196651-79196673 AGAATATGGACATCTGAAGAGGG - Intergenic
976496773 4:85739248-85739270 TGAAGATGGAAATGCATAGAAGG - Intronic
977381182 4:96275540-96275562 ATAAGGTGAAACTCTAGAGATGG - Intergenic
977657406 4:99537580-99537602 GGAAGATGGGATTCTGGAGAAGG + Intronic
978289350 4:107118955-107118977 TGAAGTTGGAAATATAGAGGAGG - Intronic
978590295 4:110317165-110317187 AGAAGTTGGGAAGCTAGAGAAGG + Intergenic
980737886 4:136914780-136914802 AGAAGTTGGAAATCCAGAGCTGG + Intergenic
980737943 4:136915720-136915742 AGAAGTTGGAAATCCAGAGCTGG + Intergenic
980822218 4:138032961-138032983 AGAAGGTAAAAATCTAGATAAGG - Intergenic
981169769 4:141607614-141607636 AGATGATGGAGATCTTGATAGGG + Intergenic
981779001 4:148403883-148403905 AGAACTTGGATACCTAGAGATGG + Intronic
982225591 4:153163171-153163193 AAATGATGTAAATCTAGAAATGG - Intronic
982433819 4:155357675-155357697 AGAATATTAAATTCTAGAGACGG + Intronic
982587811 4:157264691-157264713 AGAAGATGGAAAAGTAAAAAAGG + Intronic
983798389 4:171895403-171895425 AGAAGAGGAATATCTAGAGATGG + Intronic
984314263 4:178106082-178106104 ACAAGATGTCAATATAGAGAAGG - Intergenic
984348400 4:178560970-178560992 ATGAGATGGAAAACAAGAGATGG + Intergenic
985220845 4:187702943-187702965 AGCAGTTGGAAATATAAAGAAGG - Intergenic
985250529 4:188020307-188020329 AGATGATAGAAATATGGAGATGG + Intergenic
986301386 5:6481184-6481206 AGAAGCAGGAAATCTAGAAACGG - Intronic
990156805 5:52887079-52887101 AGAAGATGGCAATGGAGAGGAGG - Intronic
990457561 5:56002787-56002809 AGAAGATACGAATCTGGAGAAGG + Intergenic
990620845 5:57556947-57556969 AGAACATGCAAAAATAGAGAAGG - Intergenic
991389539 5:66127422-66127444 AGAAGGTGAAACTCTAGAGATGG + Intergenic
993091496 5:83432267-83432289 AGAAAATGGAAATAAAGATAAGG + Intergenic
994180040 5:96754128-96754150 AGAAGATGGAAAACCTGTGATGG + Exonic
995090432 5:108169250-108169272 AGAAGATAGAAATCTATTTAAGG + Intronic
995364921 5:111347665-111347687 AGAAGAGAGAAATCTGGACAGGG - Intronic
996033088 5:118728503-118728525 AGAAGCTGGCAATCCAGAGAAGG - Intergenic
996303080 5:122011552-122011574 AGAAAATGGAGATTTATAGAGGG - Intronic
997184738 5:131870567-131870589 TGAAGATGGAAATGTTGAGAAGG - Intronic
997766669 5:136511606-136511628 AGCTTATGGAAATCAAGAGAAGG - Intergenic
997864074 5:137445168-137445190 GGAAGAAGGAAATATAGAGAAGG - Intronic
997940233 5:138150801-138150823 AGAAAATGGAAAGCCAGAGGTGG - Exonic
998100696 5:139431404-139431426 AGAATAAGCAAATCTATAGAGGG - Intronic
998758300 5:145404803-145404825 GCAAGATGGAAATGTAGAGGAGG + Intergenic
998783998 5:145689412-145689434 AGAAGATGTGAAACTAGAGGAGG - Intronic
1000139137 5:158384362-158384384 TCAAGAAGGAAAACTAGAGAAGG - Intergenic
1001230415 5:169982419-169982441 AGAAGAGGGAAATCAAGGCAGGG - Intronic
1001424125 5:171612414-171612436 AGAACATGGAGACTTAGAGAAGG + Intergenic
1002713896 5:181213239-181213261 AGAAGACGGCATTATAGAGAGGG - Intergenic
1003657463 6:8026143-8026165 AAAAGATGGAAATGTTGAAAAGG + Intronic
1003810007 6:9768597-9768619 AGAAGATTGTAATCAAGAAATGG - Intronic
1004295165 6:14403436-14403458 AGAAGAGGGAAATTTGGAGATGG - Intergenic
1005259675 6:24044827-24044849 AGAAGACAGAAATTTAGAGAAGG - Intergenic
1005284119 6:24306107-24306129 AGGAGATGGACACCTAGAGATGG + Intronic
1006756714 6:36422658-36422680 AGAAAATGTATATCTAGAGGAGG + Intronic
1007511923 6:42380484-42380506 AGAATATGGAGGTCCAGAGAAGG - Intronic
1009345470 6:62609172-62609194 GCAAGATGGAAATCTTTAGATGG - Intergenic
1009979015 6:70703947-70703969 AGAAACTGGAAATCAAGAGATGG - Intronic
1010953952 6:82069349-82069371 AGAAGGTGGGGATCTAGAGTGGG + Intergenic
1011194919 6:84771738-84771760 CCACGATGGAAATCTAAAGATGG - Intergenic
1011505629 6:88039940-88039962 AGAGGATGGAAAACTAGCAATGG + Intergenic
1011532765 6:88342125-88342147 AAAAGAAGGAACTCCAGAGAGGG - Intergenic
1011866279 6:91832623-91832645 GGAAGATGAAAATAAAGAGAAGG + Intergenic
1012412176 6:98971190-98971212 AGAAGAAGAAAATGTAGAGCAGG + Intergenic
1012625216 6:101396309-101396331 AACAGATGGAAATCTGGAGGTGG + Intergenic
1012749376 6:103139281-103139303 AGAATATGCAATTCTAGAGAAGG + Intergenic
1012964852 6:105662516-105662538 AGAAGCTGAGAATCTGGAGATGG + Intergenic
1013494571 6:110685524-110685546 AGACAATGGAAATGTATAGATGG - Intronic
1013632761 6:112001142-112001164 AGATGAGGGAGATCCAGAGAAGG + Intergenic
1013990655 6:116251293-116251315 AGAAGCTGGAAAGAGAGAGAAGG - Exonic
1015057974 6:128927473-128927495 AGGAGATAGAAAGTTAGAGACGG - Intronic
1015575095 6:134662772-134662794 AGAGGTTGGAAACCTGGAGATGG + Intergenic
1017058629 6:150460119-150460141 AGAAGAGGGATATCTTGGGAAGG - Intergenic
1017301362 6:152863181-152863203 AGAATATGAAAACCTACAGAAGG + Intergenic
1017378808 6:153803029-153803051 AAAAGATGGCAATGTATAGAAGG + Intergenic
1017956621 6:159183590-159183612 AGAAGAGGGAAAGCCAGAGCTGG + Intronic
1021312412 7:19110790-19110812 AGAAAATAGATATCTAGAAAAGG + Intronic
1021555641 7:21915233-21915255 AAAAGATGGAAATCAAGATGGGG + Intronic
1021705189 7:23360585-23360607 AGAAGATGGAAATGTGTATAAGG - Intronic
1021717753 7:23474499-23474521 AAAAGATGGAAATCCAGGGGCGG - Intergenic
1021759919 7:23893777-23893799 AGTAGATGGAATTTTAGAAATGG + Intergenic
1022280435 7:28903322-28903344 AGAAGATGGAAAAAAAGAGTGGG + Intergenic
1022628571 7:32063415-32063437 TAAAGATTGAAAACTAGAGATGG + Intronic
1023462845 7:40419558-40419580 AGAAGAAGAAAATATGGAGAGGG - Intronic
1023585697 7:41727296-41727318 AGCAGAAGGAAACCTAGATAGGG + Intergenic
1024451346 7:49547388-49547410 AGAAGATGGAACTCAATGGACGG + Intergenic
1024613891 7:51090983-51091005 GGAAGATGGATATCCAGAAAAGG + Intronic
1026002053 7:66568022-66568044 AGAAGAAGGAAATATGGAAAAGG + Intergenic
1026638335 7:72103746-72103768 AGAAGATGGAAATGGAGGGGGGG + Intronic
1027747966 7:82102147-82102169 AGAAGATTGAAAATAAGAGAAGG + Intronic
1029050482 7:97681492-97681514 AGAGGGTGGAAATCTTTAGATGG + Intergenic
1030528169 7:110678526-110678548 AGATGCTGGAAATATACAGAAGG + Intronic
1030784987 7:113648587-113648609 AGAAGGTGAAAATTTAAAGAGGG + Intergenic
1031083948 7:117283865-117283887 AGAAGATGGAAAATGAGAGAGGG + Intronic
1031920481 7:127596495-127596517 AGGAGAAGGAAGTCTAGGGAGGG - Intronic
1031946083 7:127842067-127842089 TGAACATGGAAATCTGGAAAAGG - Intronic
1031990743 7:128197399-128197421 AGAAGACAGAGACCTAGAGAGGG + Intergenic
1032403977 7:131642651-131642673 AGAAGATGGAACCCAGGAGAGGG + Intergenic
1033137925 7:138800073-138800095 GGTAGATGGAAACCAAGAGATGG - Intronic
1033162190 7:139007526-139007548 GGAATATGGAAATCTCTAGAAGG + Intergenic
1033404686 7:141061289-141061311 AGAAGAGGGAAATTTGGAGATGG + Intergenic
1033447630 7:141436577-141436599 AGAAGGTTGAGCTCTAGAGAAGG + Intronic
1033511623 7:142065376-142065398 AGAAGAGGGAAATGTGGAGCGGG - Exonic
1033514695 7:142094405-142094427 AGAAGAGGGAAATGTGGAGCGGG - Intronic
1033524404 7:142196195-142196217 AGAAGAGGGAAATGTGGAGCGGG - Intronic
1033641241 7:143264618-143264640 AGTGGATGGGAATCTGGAGATGG - Exonic
1033950224 7:146775671-146775693 AGAAGAAGAAAATAAAGAGAGGG + Intronic
1034788985 7:153950762-153950784 AGAAGATGGAGATGCAGACATGG + Intronic
1035733994 8:1874514-1874536 AAAAGTTGGAAGTCCAGAGATGG + Intronic
1035766273 8:2108364-2108386 TGAAGAAGGACATCTTGAGAGGG + Intronic
1035771555 8:2151398-2151420 AGATAATGGAAATGTAGAAATGG - Intronic
1036387855 8:8297302-8297324 AGCAGCTGGAAATCAAGAGAAGG + Intergenic
1036663424 8:10722939-10722961 AAAGGATGCAAATCTAGTGAGGG - Intergenic
1036915600 8:12800622-12800644 AGAAGTTAGCAGTCTAGAGAAGG - Intergenic
1037051078 8:14374924-14374946 AGGAGATGGAAATCAATAAAGGG + Intronic
1037103049 8:15071814-15071836 AGAAGAGGGGAATATAAAGAAGG + Intronic
1038421958 8:27439192-27439214 AGAAGAAGGAAGTCTACAGTTGG + Intronic
1039124832 8:34189740-34189762 AGAAGAGGGGAATAGAGAGAAGG - Intergenic
1039254094 8:35699862-35699884 AAAAGAGTCAAATCTAGAGATGG + Intronic
1039689438 8:39848422-39848444 AGGAGATCCAAATCTAAAGAAGG - Intergenic
1040398027 8:47018325-47018347 AGAAGATGGAGAAACAGAGATGG + Intergenic
1041062206 8:54045112-54045134 AGAAGAGGAAACTCTAGAGAAGG - Intergenic
1041241802 8:55854741-55854763 AGAAGGTGGGAAGCAAGAGAGGG - Intergenic
1041941254 8:63390541-63390563 AGAACAAGGAAATATAGGGATGG - Intergenic
1042611010 8:70601217-70601239 GAAAGATGGGAATCTAGTGAAGG - Intronic
1042819818 8:72917808-72917830 TGAAGATGGAATTCTACTGATGG + Intronic
1043234315 8:77842552-77842574 AGAAGAGGGAAATGTAGACACGG - Intergenic
1043240715 8:77931298-77931320 ACATGGTGTAAATCTAGAGATGG - Intergenic
1043385773 8:79746557-79746579 AGAACATGGGACTCTAGAAAAGG + Intergenic
1043402437 8:79897218-79897240 AGGAGCTGGAAACCTAGTGAAGG - Intergenic
1044113941 8:88311128-88311150 TGAAGATGGAGATTTAGAGACGG + Intronic
1044721884 8:95159079-95159101 AGAATCAGGAACTCTAGAGATGG - Intergenic
1046785772 8:118264874-118264896 AGTAGATAGAAGTCTTGAGAAGG - Intronic
1047017773 8:120741838-120741860 AGAAGAAGGAGAAATAGAGAAGG + Intronic
1047189565 8:122665843-122665865 GGAAGAGGGGAATCCAGAGAGGG - Intergenic
1047738883 8:127791044-127791066 AGAGGATGCAGATATAGAGAAGG + Intergenic
1048095248 8:131285035-131285057 AGAAAATGGAAATCCAGGAAGGG - Intergenic
1048355879 8:133653783-133653805 AGGAGAAGGAAAACCAGAGAGGG + Intergenic
1048578548 8:135711850-135711872 AGAAGATGGAAATCTTCTGTTGG + Intergenic
1048664784 8:136648831-136648853 AGTAGCTAGGAATCTAGAGAAGG + Intergenic
1049096272 8:140550132-140550154 AGGAGGTGGAAGCCTAGAGAGGG - Intronic
1049709115 8:144055812-144055834 AGAAGATGGACAGCTGGATAGGG + Exonic
1049855659 8:144860218-144860240 AGAAGAAGGAGATGTAGAGCTGG + Intergenic
1051443252 9:17111159-17111181 AGAAAATGGAGAACAAGAGATGG - Intergenic
1052083269 9:24232784-24232806 AGGAATTGGAAATCTAGACAGGG + Intergenic
1052350403 9:27452860-27452882 AGAAGCTGGAGGTATAGAGAGGG + Intronic
1053014540 9:34654456-34654478 AGCAGATGGAAATGGAGACAGGG - Intronic
1054346002 9:63915557-63915579 AGAAAATGGAAAACAAAAGAAGG + Intergenic
1054865730 9:69999164-69999186 AGAAGATGGAAAACTTGTGTTGG + Intergenic
1055524855 9:77121953-77121975 TGAAGATGGAATTCAAGATAAGG + Intergenic
1055561325 9:77524940-77524962 AGAAAATGGAAAAACAGAGATGG + Intronic
1056874244 9:90312651-90312673 AGAAGAAGGAAGTCTAATGATGG - Intergenic
1056982545 9:91328420-91328442 AGAGGCTGGAAAGCCAGAGAAGG + Intronic
1058069826 9:100590616-100590638 AGATGATGGAACTGCAGAGATGG + Intergenic
1058207215 9:102123575-102123597 ACAGGATGGAAATCTAAGGATGG - Intergenic
1058746871 9:108000195-108000217 AGGAGATGGAGATGCAGAGAAGG - Intergenic
1059320762 9:113466924-113466946 AGAACAGGCAAATCTACAGAGGG - Intronic
1059652014 9:116323799-116323821 AGAAGCTGGAAATCAAAAGCTGG + Intronic
1186399157 X:9240956-9240978 TTTAGATGGAAATCTAAAGAAGG + Intergenic
1186473471 X:9838880-9838902 AAAAGAGGCAAATCCAGAGACGG + Intronic
1186796466 X:13051113-13051135 AAAAGATGGAAAGGCAGAGAGGG + Intergenic
1187248688 X:17577032-17577054 AGAAGGAGGAAAACCAGAGAAGG - Intronic
1187861373 X:23686924-23686946 TGAAGATGTAAATTTAGAGATGG - Intergenic
1188782366 X:34301478-34301500 ATAATCTGGAAATATAGAGATGG - Intergenic
1188930295 X:36100996-36101018 AGAAGAAGGAACTCTCCAGAGGG - Intronic
1191680790 X:63837956-63837978 AGAAAATTGAGGTCTAGAGAGGG - Intergenic
1194665106 X:96668575-96668597 AGAAGTTTGCACTCTAGAGAAGG + Intergenic
1194945520 X:100062074-100062096 AGAAGATGAAGAGATAGAGAAGG + Intergenic
1196091259 X:111746063-111746085 AGAAGATGGATTAATAGAGATGG - Intronic
1196145883 X:112316377-112316399 AGGAAGTGGAGATCTAGAGAAGG - Intergenic
1196207885 X:112961746-112961768 TGAAAATGGAAATTTACAGAAGG + Intergenic
1196213355 X:113021440-113021462 CCAAGATGGAAAGCTAGAGGTGG - Intergenic
1196514497 X:116553688-116553710 ATGTTATGGAAATCTAGAGAAGG - Intergenic
1197054789 X:122104613-122104635 AGATGATGGAAATATAGAATGGG + Intergenic
1197157248 X:123283687-123283709 AGAGAAGGGGAATCTAGAGAGGG - Intronic
1197852345 X:130876387-130876409 AGAATAGGCAAATCTATAGAGGG + Intronic
1198459066 X:136846303-136846325 AACAGATGGAAAATTAGAGAAGG - Intergenic