ID: 1088080533

View in Genome Browser
Species Human (GRCh38)
Location 11:105906615-105906637
Sequence GGGCTATGCCATTAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088080533_1088080537 4 Left 1088080533 11:105906615-105906637 CCATCTTCTTAATGGCATAGCCC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1088080537 11:105906642-105906664 GCAGGCTGCCAGCTAATACGTGG 0: 1
1: 0
2: 0
3: 5
4: 59
1088080533_1088080539 12 Left 1088080533 11:105906615-105906637 CCATCTTCTTAATGGCATAGCCC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088080533 Original CRISPR GGGCTATGCCATTAAGAAGA TGG (reversed) Intronic
900309438 1:2026335-2026357 CGCCTAGGCCATGAAGAAGAAGG - Intronic
901649358 1:10734807-10734829 AGTCCATGCCATTAAGGAGAGGG + Intronic
903055389 1:20632895-20632917 GGCCTATGCCATTAAACAAACGG + Intergenic
903475915 1:23619082-23619104 GGGGTATCCAAGTAAGAAGAGGG + Intronic
903913132 1:26743332-26743354 AGGCTATGCCAATATGAAAATGG - Intronic
904113553 1:28145424-28145446 GGGATATGTCAAAAAGAAGAGGG + Intergenic
913325128 1:117621457-117621479 AGGCTCTCCCATCAAGAAGAAGG - Intronic
920408739 1:205740875-205740897 GGGCTAAACCATTAACAAGTTGG - Intronic
921317798 1:213908458-213908480 GGGCTAAGACATTACCAAGAAGG + Intergenic
924693910 1:246380526-246380548 AGGATATGGCATTCAGAAGAAGG - Intronic
1063587786 10:7368307-7368329 GGGCTATTCCATGAACAACATGG + Intronic
1063595702 10:7433776-7433798 GAGGTATGCAATTAAGAAAACGG + Intergenic
1065632262 10:27692447-27692469 TGGCTATTCCAGTTAGAAGAAGG - Intronic
1067085173 10:43234389-43234411 AGGCTGTGCCTTTTAGAAGAGGG - Intronic
1080056438 11:27911456-27911478 GGGCACTGCCAGTAGGAAGAGGG + Intergenic
1086440440 11:86824079-86824101 GGGCTCTGCCGTTTAGAAGAAGG + Intronic
1086830086 11:91551341-91551363 GGCCCATGCCATAAATAAGAAGG + Intergenic
1088080533 11:105906615-105906637 GGGCTATGCCATTAAGAAGATGG - Intronic
1091706108 12:2694536-2694558 GGCCTATTGGATTAAGAAGAAGG - Intronic
1094059797 12:26301584-26301606 GGGCTGTGCGATGAAGGAGAGGG - Intergenic
1095351873 12:41223048-41223070 GAGCTTTGCCATTTAAAAGAAGG - Intronic
1095425843 12:42073869-42073891 AGTCTATGCCTTTAAGAACATGG - Intergenic
1098708742 12:73726339-73726361 GGGCTAAGCCATGAAGAACTAGG + Intergenic
1104710515 12:130982547-130982569 AGTCTATACCACTAAGAAGAAGG - Intronic
1104993736 12:132641525-132641547 TGGCTCTGCCATTAAGACTAAGG + Intronic
1107606464 13:42062379-42062401 GGACTATGAGATTAGGAAGAAGG + Intronic
1112314775 13:98351196-98351218 GGCCACTGCCATTCAGAAGAGGG - Intronic
1115906724 14:38209641-38209663 GCGCTATGCCAAGATGAAGACGG + Exonic
1121037785 14:90720794-90720816 GGGCTATGCCTTTAGGAAAGGGG - Intronic
1121088266 14:91163299-91163321 GGGCTTTGGCAGTAAGAAGCGGG + Intronic
1125114863 15:36078661-36078683 ACGGTATGCCATTAAGAAGGAGG - Intergenic
1127731605 15:61807117-61807139 GGGCTATGCCAGTTAGACTATGG + Intergenic
1129059359 15:72848519-72848541 GGGCTGGGACACTAAGAAGAAGG + Intergenic
1131388186 15:92025065-92025087 AGGACATGCCATTAAGAGGATGG - Intronic
1136662578 16:31777282-31777304 GAGCAATCCCATTAAGAAGTAGG + Intronic
1137611375 16:49820267-49820289 GGGCTATGGGATTAAGCAGAGGG - Intronic
1139902877 16:70342010-70342032 GGGCTATGTCATAGAGAAGTTGG + Intronic
1141362564 16:83409659-83409681 GGGAGATGCCATTTTGAAGAGGG - Intronic
1142275734 16:89117925-89117947 GGGCTCTGCCTTAGAGAAGAGGG - Intronic
1142275745 16:89117979-89118001 GGGCTCTGCCTTAGAGAAGAGGG - Intronic
1142275757 16:89118033-89118055 GGGCTCTGCCTTAGAGAAGAGGG - Intronic
1143214859 17:5217212-5217234 GGTCTTTGCCATTCAGAAAAAGG + Intronic
1145841073 17:27995204-27995226 GGGCTATTCCATTTTGAGGAAGG - Intergenic
1150603925 17:66675333-66675355 AGGCGATGACATTAAGAGGAGGG - Intronic
1151096630 17:71506709-71506731 GGGCTTTTCCCTTAAGAAAAAGG - Intergenic
1155868224 18:30992908-30992930 GGCCAATGCCACTCAGAAGAAGG + Exonic
1157179008 18:45478902-45478924 GGACTCTTCCATTAAGAAAAGGG - Intronic
1158296797 18:56006525-56006547 GGGCTGTGCCCTTAAAAAGAAGG - Intergenic
1167080901 19:47275435-47275457 GAGCGATGTCATTAGGAAGAAGG - Exonic
1168693939 19:58394693-58394715 CTCCTATGCCATTAAGAAGAAGG + Exonic
926036596 2:9640690-9640712 GGCCTGTGCCTTTGAGAAGAAGG + Intergenic
927466671 2:23341861-23341883 GGGGAATGCCATTAATATGATGG - Intergenic
930297117 2:49568912-49568934 TGGCTTTGCCACTAAGAAAATGG + Intergenic
931684340 2:64780762-64780784 GGCCTTGGCCATTAAGTAGAAGG - Intergenic
931968371 2:67558922-67558944 AGGATATGCCATTATGAAGAAGG + Intergenic
932905981 2:75751898-75751920 AGGCTCTGACATTAAGAAGGAGG + Intergenic
933092196 2:78135427-78135449 GTGCTATGCCACTTAGAAGATGG + Intergenic
933781346 2:85803938-85803960 GTGCTCAGCCATTAAGAGGAAGG - Intergenic
935971881 2:108537508-108537530 GGCCAGTGCCATTATGAAGAGGG + Intronic
937888643 2:126917794-126917816 GGGCTATACCTTCAATAAGATGG + Intergenic
940975677 2:159941129-159941151 GGTCTTTGCCATTTAAAAGAAGG + Exonic
941994133 2:171585546-171585568 GGGTTATGCCTTTAAGATGAAGG + Intergenic
945064899 2:205940235-205940257 GGGCAATGGCAAAAAGAAGAGGG + Intergenic
946898091 2:224345328-224345350 GGGCACTGCCTGTAAGAAGAGGG - Intergenic
1170816366 20:19717789-19717811 GGGCCATGCCTTTGAGAGGAAGG - Intronic
1183243378 22:36674758-36674780 GTGCTATGCCACTGGGAAGAGGG + Intronic
1183265205 22:36820643-36820665 GGGCTGTGGCATGAACAAGAGGG + Intergenic
950119784 3:10474159-10474181 GAGCTATGCCATTAGGAAGAGGG + Intronic
952207270 3:31192297-31192319 GGGCTAGCCCAGGAAGAAGAGGG - Intergenic
955000647 3:54924330-54924352 GGAGTATGCTATTAAGAAGGAGG - Intronic
955168501 3:56539551-56539573 GGCCCATGCCATTGAGATGATGG - Intergenic
957467734 3:80616487-80616509 GGGCTATGGCAGCAAGGAGATGG + Intergenic
957520714 3:81314623-81314645 AGGCCATACCATTAAGCAGATGG + Intergenic
958802912 3:98777186-98777208 GGGAGATGCCCTTAAGAAGAAGG - Intronic
960052852 3:113254329-113254351 GGGCTGTGTCATGAAAAAGAGGG + Intronic
960270320 3:115666802-115666824 GGGCTTTGTCATTCAGAAGCTGG + Intronic
961360978 3:126366823-126366845 GGGCTATGGCATGAGGAAGGGGG + Intergenic
961748099 3:129078770-129078792 GGGCCATGCCCTTAAGGAAAGGG + Intergenic
962215023 3:133513754-133513776 GAACTATGGCTTTAAGAAGATGG + Intergenic
964005787 3:151826873-151826895 AAGCTTTGCCATGAAGAAGAAGG - Intronic
966211972 3:177462968-177462990 GGGGTATTTCCTTAAGAAGAGGG + Intergenic
973757116 4:54086260-54086282 GGGCTCTGCCCTCAAGCAGAGGG + Intronic
974046960 4:56906801-56906823 GGGGTTTGCCAGTAGGAAGATGG - Intergenic
975357915 4:73429941-73429963 GGACTAAGACATTAAGAAAAGGG + Intergenic
979559800 4:122089128-122089150 GGGCTATCTGATTAATAAGAGGG + Intergenic
983495277 4:168436260-168436282 TGTCTATTCCAGTAAGAAGAGGG - Intronic
987561893 5:19534816-19534838 AGGCTAGGTCATAAAGAAGATGG + Intronic
987799887 5:22681032-22681054 GGGCTATGCATTCAAGTAGAAGG + Intronic
993148020 5:84121447-84121469 AGGGGACGCCATTAAGAAGAAGG - Intronic
994634954 5:102333290-102333312 GGGCTATGCCACCAAAAATAAGG + Intergenic
995255148 5:110037248-110037270 TGTCTAGGCCATGAAGAAGATGG + Intergenic
997720953 5:136078101-136078123 AGGCTTTGCCATAAAGAGGACGG + Intergenic
1001008058 5:168072514-168072536 CGGCTCTGCCTTTAAGGAGATGG + Intronic
1001969860 5:175946923-175946945 GGTCCATGCCTTTAATAAGAAGG + Intronic
1002247578 5:177896845-177896867 GGTCCATGCCTTTAATAAGAAGG - Intergenic
1003398040 6:5770034-5770056 GGGCTCTGGCATTCAGATGAGGG + Intronic
1004124637 6:12860970-12860992 GGGCAATGACATTTTGAAGATGG - Intronic
1005703548 6:28428878-28428900 GTGCTGTGACATTAAGAAAATGG + Intergenic
1007289454 6:40774215-40774237 GGGTTCTGCCAGCAAGAAGAAGG + Intergenic
1008092489 6:47308085-47308107 TGGCCATGCCATTAATAAGTGGG + Intronic
1008560429 6:52719702-52719724 AGGTGATGCCATTAAGAAGTGGG + Intergenic
1009712799 6:67346874-67346896 GGTCTGTGCCATAAAGAAGGGGG + Intergenic
1013087989 6:106872884-106872906 TAGCTATACCATTAAGAAGGAGG + Intergenic
1013991447 6:116258536-116258558 CTCCTATGCCATTAAGAAGAAGG - Intronic
1014687918 6:124526724-124526746 GGACTATGCCTTTTACAAGATGG - Intronic
1015606410 6:134959563-134959585 GGTCTGTGCCATTCATAAGAGGG - Intergenic
1017020684 6:150137598-150137620 GGAGTGTGCCATTAAGATGAAGG + Intergenic
1017578925 6:155838907-155838929 TGGCTAAGTCAGTAAGAAGAAGG + Intergenic
1018691376 6:166346714-166346736 GGGATATTCCAATAAGGAGAAGG - Intergenic
1020019401 7:4853867-4853889 GGCTTATGCTATTAAGAGGAAGG - Intronic
1022864337 7:34401484-34401506 CTTCTATGCCATCAAGAAGAAGG + Intergenic
1023355540 7:39363644-39363666 GGCCTACGAGATTAAGAAGAGGG + Intronic
1024510752 7:50202901-50202923 GGGCTCTCCCATCAAGAAGTGGG - Intergenic
1030090054 7:105850511-105850533 GTGATATCCCATTAAGCAGATGG + Intronic
1036646375 8:10613161-10613183 TGGCGATGACATGAAGAAGAAGG - Exonic
1038412510 8:27369173-27369195 GGGCAAGGCCTTTAAGAAGAGGG - Intronic
1048088024 8:131205256-131205278 GGGGTATGCAACTAAGAAGTTGG + Intergenic
1050620877 9:7450684-7450706 GGGCAAAGTCATCAAGAAGAAGG + Intergenic
1053651325 9:40172873-40172895 GGGCCCAGCCATTAGGAAGATGG + Intergenic
1053901718 9:42802226-42802248 GGGCCCAGCCATTAGGAAGATGG + Intergenic
1054533255 9:66203330-66203352 GGGCCCAGCCATTAGGAAGATGG - Intergenic
1055685538 9:78769778-78769800 GAGCTTTGCCTGTAAGAAGAGGG + Intergenic
1056441555 9:86627155-86627177 GGTCTATGCTGTTAAGAATAAGG + Intergenic
1059500958 9:114753747-114753769 GGGGTATGACATAGAGAAGAAGG + Intergenic
1186126687 X:6422127-6422149 CTCCTATGCCATCAAGAAGAAGG - Intergenic
1186994102 X:15101484-15101506 GGGCTATGTCATATAGAAAAAGG - Intergenic
1187174622 X:16884950-16884972 GGCCTATCCCCTTAAGTAGATGG + Intergenic
1188179016 X:27030576-27030598 GGGATATTCCATGAAGAACAGGG + Intergenic
1189853012 X:45195537-45195559 GAGCTATGGGATGAAGAAGAGGG - Intronic
1196462081 X:115942198-115942220 GGAGTAGGCCATTAGGAAGATGG + Intergenic
1196893027 X:120308804-120308826 GCGCTTTGCAATTAAGAAGATGG - Intronic
1197657467 X:129132704-129132726 GGACTCTGACATTAAGAAGTTGG + Intergenic
1197878602 X:131139472-131139494 GGCATCTGCAATTAAGAAGATGG - Intergenic
1197984700 X:132255326-132255348 GGTCTATCCCTTCAAGAAGAGGG + Intergenic
1198213489 X:134536012-134536034 GGACTATGCTATAAACAAGAGGG - Intergenic
1200878220 Y:8182375-8182397 GGGCTATGCCTTTCAAAGGAGGG - Intergenic
1200893895 Y:8354329-8354351 GGCCTATGCCTTTAAAAAGGTGG - Intergenic