ID: 1088080535

View in Genome Browser
Species Human (GRCh38)
Location 11:105906635-105906657
Sequence TTAGCTGGCAGCCTGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088080535_1088080539 -8 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45
1088080535_1088080540 14 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080540 11:105906672-105906694 GAGCCTACCTGATCCAGATCAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1088080535_1088080542 19 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080542 11:105906677-105906699 TACCTGATCCAGATCAGGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1088080535_1088080546 29 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080546 11:105906687-105906709 AGATCAGGAGTGGCAGGAGATGG 0: 1
1: 0
2: 5
3: 51
4: 605
1088080535_1088080544 23 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080544 11:105906681-105906703 TGATCCAGATCAGGAGTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088080535 Original CRISPR TTAGCTGGCAGCCTGCACGA GGG (reversed) Intronic
905500594 1:38433375-38433397 TTTGATGGAAGCCTGCAGGAAGG - Intergenic
907401607 1:54228155-54228177 TTAGCTGGCAGGCTGCAGCCCGG + Intronic
907869822 1:58432933-58432955 AAAGCTGGCAGCCAGCAGGAGGG - Intronic
908878598 1:68705643-68705665 TTAGATGGAATCCTGCACCAGGG + Intergenic
915440070 1:155940416-155940438 TTAGCTGGCAGAGGGCAAGAAGG + Intergenic
918667740 1:187172584-187172606 TTGGCAAGCAGCCTGCATGATGG - Intergenic
919638836 1:200029897-200029919 TTACCTCGTAGCCTCCACGAGGG + Intronic
924533861 1:244917518-244917540 TTAGCTTTCATCCAGCACGAGGG + Intergenic
1067797101 10:49328540-49328562 CTAGCCGGCTGCCTGCAAGAGGG - Intergenic
1075476958 10:122744439-122744461 TTAGCAGGCAGCCTGGAGCATGG + Intergenic
1075963399 10:126588270-126588292 CTTGCTGGCAGTCTGCATGAGGG + Intronic
1076329159 10:129652356-129652378 TGAGCTGCCTGCCTGCACGGTGG + Intronic
1078143695 11:8709115-8709137 TTGCTTAGCAGCCTGCACGAGGG - Intronic
1078170525 11:8925838-8925860 GTAGCTGGCAGCAGGCATGATGG + Exonic
1079544672 11:21618747-21618769 GTAGCCAGCAGCCTGCACAATGG + Intergenic
1083697715 11:64453748-64453770 TGAGCTGACAGCCTCCACAATGG - Intergenic
1088080535 11:105906635-105906657 TTAGCTGGCAGCCTGCACGAGGG - Intronic
1089061429 11:115629313-115629335 GTAGCTGGGAGCCTGCACTGTGG - Intergenic
1096242652 12:49967545-49967567 CTAGCTGGAAGCCTGCCCAAGGG - Intronic
1102494912 12:113312842-113312864 TGAGCTGGAAGCCTGTACTAGGG - Intronic
1102565286 12:113793492-113793514 TGAGCTGGCAGCCAGCAATATGG - Intergenic
1104755422 12:131266451-131266473 GGAGCTGGCAGCCAGCAGGAGGG + Intergenic
1105627272 13:22125096-22125118 TTTGCTGAGAGCCTGCACGCAGG + Intergenic
1108808269 13:54186724-54186746 ATAATTGGCAGCCTGCACCAGGG + Intergenic
1109515765 13:63440913-63440935 TAAGTTGGCAGCCAGCACCAGGG + Intergenic
1113341900 13:109433763-109433785 TTATCTGGCAGCAGGCAAGAGGG + Intergenic
1118715671 14:68558148-68558170 TTAGCTGTCAGCCATCACCATGG + Intronic
1120697070 14:87656695-87656717 TTAGCTGGAGGCCTGCAGGTAGG + Intergenic
1129883495 15:79022728-79022750 TTAGCTGGTTGGCTGCACAAGGG - Intronic
1134513228 16:14865605-14865627 TTAGCTGGCTCTCTGCACAACGG - Intronic
1134700865 16:16264094-16264116 TTAGCTGGCTCTCTGCACAACGG - Intronic
1134970959 16:18530565-18530587 TTAGCTGGCTCTCTGCACAACGG + Intronic
1138824421 16:60301958-60301980 TTAGATGGCAAACTGCACGAGGG - Intergenic
1140402798 16:74685196-74685218 TTAGATGCCAGCCTGGAAGAGGG - Intronic
1141280829 16:82628222-82628244 TGAGCTGGCAGCCTGCAAGTGGG + Intronic
1148731541 17:49839773-49839795 TTTGCTGCCAGTCTGCAAGATGG - Intronic
1154166166 18:12015950-12015972 TGAGCTAGCAGCCTGCAGGCTGG - Intronic
1158447607 18:57534650-57534672 TTATCTGGCTGCCTGCCCTATGG - Intergenic
1161444025 19:4307884-4307906 CCAGCTGGCTGCCTGCACGCGGG + Exonic
1164777890 19:30868415-30868437 TTTGCTGGAACCCTGCAGGAGGG + Intergenic
929206730 2:39304351-39304373 TTAGCTGGCAGTTGGCACCAAGG - Intronic
935400767 2:102657717-102657739 ATAGCCGGCATCCAGCACGATGG - Exonic
936316333 2:111427579-111427601 TGGGCTGGCAGCCTGCCCCAGGG - Intergenic
941077792 2:161025807-161025829 TTGGCTGTCAGCTTGCACGTTGG - Intergenic
1173654449 20:44690104-44690126 TCAGCTGGAAGCCAGCAGGATGG + Intergenic
1174299846 20:49573585-49573607 TTAGGGGGCAGCCTGAAAGAGGG + Intergenic
1178063160 21:28874282-28874304 TTAGCAGACACCCTGCGCGAAGG + Exonic
1181033137 22:20157743-20157765 TAAGCTGGCCTCCTGCACGCTGG - Intergenic
1181045494 22:20212235-20212257 TCAGCTGGCCGCCTACTCGATGG - Intergenic
1181618027 22:24068297-24068319 TTACCTGGCAGGCTGCAAGGTGG + Intronic
1182877092 22:33701604-33701626 TTGGCTGCCAGCCTGCAACAAGG - Intronic
1184821239 22:46910580-46910602 TTAGCTGGCAGGCAGCCCGAAGG + Intronic
950710211 3:14808691-14808713 TTAGCTGTCAGCCTGTGCAAAGG - Intergenic
961324684 3:126103213-126103235 TCAGCTGGTAGCCAGCCCGAGGG - Intergenic
965299078 3:166987824-166987846 TAAATTGGCAGCCTGCACCAGGG + Intergenic
966486279 3:180474659-180474681 TTACCTGGCAGCAGGCAAGAGGG + Intergenic
987756904 5:22108235-22108257 TTACATGGCAGCCCGCAAGAAGG - Intronic
989328273 5:40225303-40225325 TTAGGTGGCAGCAGGCAAGAGGG + Intergenic
1000324343 5:160160756-160160778 TTCGCTGGCAGCTGGCAGGAGGG + Intergenic
1005759670 6:28956685-28956707 TTACTTGGCACCCTGCACAAAGG + Intergenic
1013755534 6:113457261-113457283 TTAGCTGGCAGCCAGGAAGTGGG + Intergenic
1017813045 6:157997845-157997867 TGTGCTGACAGCCTCCACGATGG - Intronic
1020978062 7:15032470-15032492 TTAGCTGGCAGCCGGCAAAGAGG - Intergenic
1026185292 7:68078162-68078184 TTATCTGGCAGCCTGCATGCTGG - Intergenic
1033453321 7:141480997-141481019 GTAGCTGGAAGCCTGTAGGAAGG + Intergenic
1034981991 7:155485027-155485049 TTATCTGACAGCCTGAACAAAGG + Intronic
1041343683 8:56872847-56872869 TTAACAGGCAGCCTGCAAAATGG + Intergenic
1042047623 8:64671625-64671647 CTAGCTGCCAGCCTGCCCTATGG + Intronic
1047770256 8:128025081-128025103 TGAGCTGGCAGGCAGAACGAAGG - Intergenic
1048206344 8:132418262-132418284 TTAACTGGCAGCCAGCAAGAAGG + Intronic
1049367367 8:142246901-142246923 TCAGATGGCAGCCTTCATGATGG - Intronic
1050191296 9:3029370-3029392 TTAGGTTGCAGCCTACATGAGGG + Intergenic
1051997254 9:23232999-23233021 TAAGTTGGCAGCCAGCACCAGGG + Intergenic
1058278248 9:103074978-103075000 TAATTTGGCAGCCTGCACCATGG - Intergenic
1060907350 9:127318696-127318718 TTAGGTGGCAGCCTCCCCTAGGG + Intronic
1186444171 X:9611911-9611933 TGACCTGGCAGGCTGCACGGAGG - Intronic
1188401240 X:29747508-29747530 TGAGCTGGCACACTGCACAAGGG - Intronic
1188841111 X:35018618-35018640 TTAGATGATAGCCTGCACTAGGG + Intergenic