ID: 1088080536

View in Genome Browser
Species Human (GRCh38)
Location 11:105906636-105906658
Sequence ATTAGCTGGCAGCCTGCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088080536_1088080544 22 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080544 11:105906681-105906703 TGATCCAGATCAGGAGTGGCAGG 0: 1
1: 0
2: 0
3: 9
4: 145
1088080536_1088080540 13 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080540 11:105906672-105906694 GAGCCTACCTGATCCAGATCAGG 0: 1
1: 0
2: 0
3: 3
4: 82
1088080536_1088080542 18 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080542 11:105906677-105906699 TACCTGATCCAGATCAGGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1088080536_1088080546 28 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080546 11:105906687-105906709 AGATCAGGAGTGGCAGGAGATGG 0: 1
1: 0
2: 5
3: 51
4: 605
1088080536_1088080539 -9 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088080536 Original CRISPR ATTAGCTGGCAGCCTGCACG AGG (reversed) Intronic
901472429 1:9466923-9466945 ATTAGGTGGCAGACTACACTCGG + Intergenic
902116297 1:14124397-14124419 ATTAGGTGCCAGGCTGCATGAGG - Intergenic
903706872 1:25292470-25292492 ATTTGCTGATAGACTGCACGTGG + Intronic
903720360 1:25400872-25400894 ATTTGCTGATAGACTGCACGTGG - Intronic
912169996 1:107087830-107087852 TTTAGCTGTCAGCCTCCTCGTGG + Intergenic
921886717 1:220314463-220314485 ACCAGCTGGAAGCCTGCAGGAGG + Intergenic
923539137 1:234875814-234875836 ATTGTCTGGCAGCCTCCCCGCGG - Intergenic
1065761624 10:28988161-28988183 ATTTGCTGGTAGCCTGCATTTGG - Intergenic
1066673185 10:37861019-37861041 ATTAGTTGGCAGCCTGTAACTGG - Intergenic
1076176730 10:128373957-128373979 ATTGGCCTCCAGCCTGCACGGGG - Intergenic
1083966391 11:66046483-66046505 ATGAGATGGCAGCCTGGGCGGGG + Intronic
1084534400 11:69748180-69748202 ATGAGAGGGCAGCCTGCAAGTGG - Intergenic
1088080536 11:105906636-105906658 ATTAGCTGGCAGCCTGCACGAGG - Intronic
1088727446 11:112652211-112652233 ATGAGGTAGCAGCCTGCACAAGG - Intergenic
1091387218 12:103088-103110 ATTAGCTGGCAGCAGGGAGGCGG - Intronic
1095749563 12:45696142-45696164 CTTGGCTGGCAGGCTGCACTCGG + Intergenic
1098741260 12:74176365-74176387 ATTATCTGCCAGCATGTACGAGG - Intergenic
1101478008 12:105069686-105069708 ATAAGCTGGAAGCCTACACTTGG - Intronic
1102494913 12:113312843-113312865 ATGAGCTGGAAGCCTGTACTAGG - Intronic
1102683046 12:114703389-114703411 ATGAGTTGGGAGCCTGCAGGGGG - Intergenic
1106052914 13:26208167-26208189 CTTAGCTGGCAGCCTGGAACTGG + Intronic
1109515764 13:63440912-63440934 ATAAGTTGGCAGCCAGCACCAGG + Intergenic
1113489714 13:110681606-110681628 ATGAGCTGAAAACCTGCACGTGG + Intronic
1113788123 13:113013570-113013592 ATTATCTGGCAGCCTCCGCTGGG + Intronic
1121726097 14:96151242-96151264 GTTATCTGGCAGCTTTCACGAGG - Intergenic
1122908391 14:104813923-104813945 ATTAGCTGGCCCCCTGCCCATGG - Intergenic
1123186705 14:106524787-106524809 AAAAGCTGGAAGCTTGCACGGGG - Intergenic
1129883496 15:79022729-79022751 ATTAGCTGGTTGGCTGCACAAGG - Intronic
1130744677 15:86638428-86638450 ATATGATGGCAGCCTGAACGCGG - Intronic
1135698153 16:24608617-24608639 ATTTGCTGGCACTCTGCAGGTGG - Intergenic
1138724612 16:59122169-59122191 ATAATCTGGCAGCCTGTAGGGGG + Intergenic
1138824422 16:60301959-60301981 ATTAGATGGCAAACTGCACGAGG - Intergenic
1139826629 16:69762419-69762441 GTGGGCTGGCTGCCTGCACGGGG + Intronic
1141280828 16:82628221-82628243 GTGAGCTGGCAGCCTGCAAGTGG + Intronic
1142875358 17:2849177-2849199 AATAGCTGGGACCCTGCCCGTGG + Intronic
1143967050 17:10763069-10763091 ATTATCTGGCAGCCATCAGGAGG - Intergenic
1147270874 17:39269936-39269958 ATTAGGTGGGAGCCAGCACATGG - Intronic
1159413391 18:68110686-68110708 TTTCTCTGGCAGCCTGCATGAGG - Intergenic
1161444023 19:4307883-4307905 ACCAGCTGGCTGCCTGCACGCGG + Exonic
1163825816 19:19524255-19524277 ATTTGCATGCAGCCTGCACAGGG - Intronic
1165180180 19:33960670-33960692 AGAAGCTGGCAGCCTGCACCAGG - Intergenic
925061825 2:897317-897339 AGCAGCTGGCACCCTGCACCTGG + Intergenic
929320686 2:40540380-40540402 ACTAGCAGGCAGCATGCAGGAGG - Intronic
931666472 2:64612875-64612897 ATTTGCTGTCATCCTCCACGAGG + Intergenic
937078017 2:119121201-119121223 ACTAGCTGGCACCATGCACCAGG + Intergenic
943049244 2:182895334-182895356 ATTAGTTGGCAGCCTGTAATTGG - Intergenic
947387818 2:229609512-229609534 ATTATCTGGCTGCCTTCACATGG + Intronic
948686986 2:239675928-239675950 ATGAGCAGGCAGCCTGCAGGAGG - Intergenic
1171428058 20:25060794-25060816 ATTTGCTGACAGGCTGCATGTGG - Intergenic
1174747321 20:53076316-53076338 ATTTGCTGGCAAACTGCACATGG + Intronic
1179908336 21:44435491-44435513 ATTAGAGGGCACCCTCCACGGGG + Intronic
1180788082 22:18558038-18558060 ATGAGATGGCAGCCTACATGTGG + Intergenic
1181233656 22:21437280-21437302 ATGAGATGGCAGCCTACATGTGG - Intronic
1181244994 22:21497563-21497585 ATGAGATGGCAGCCTACATGTGG + Intergenic
1184298853 22:43543275-43543297 CTGACATGGCAGCCTGCACGTGG - Intronic
956302831 3:67791020-67791042 ATTCCCTGGCAGCCTGCTTGCGG - Intergenic
956766682 3:72490184-72490206 ATTAGCTGACAGCCTATACAAGG + Intergenic
956792325 3:72689754-72689776 ATTATCTGGCAGGCTGCTCAGGG - Intergenic
964955208 3:162346436-162346458 ATTGTCTGGCAGCCTTCATGGGG + Intergenic
965299077 3:166987823-166987845 ATAAATTGGCAGCCTGCACCAGG + Intergenic
968510876 4:995411-995433 ACTGGGTGGGAGCCTGCACGGGG + Intronic
971858882 4:32079155-32079177 AATAGCTTGCATCCTGCACCTGG - Intergenic
975813225 4:78191089-78191111 ATTGGCTGGCAGCTTGCTCTTGG + Intronic
977648754 4:99444878-99444900 ATGAGCTGGAAGCCAGCAAGTGG + Intergenic
978536004 4:109763695-109763717 ATTATCTAGAACCCTGCACGTGG + Intronic
981099834 4:140817768-140817790 ATCAGCTGGCATCCTACATGTGG - Intergenic
994451428 5:99949655-99949677 GTTAGATGGCAGCCTGCATGAGG - Intergenic
996583962 5:125063923-125063945 AAAAGCTGGAAGCTTGCACGGGG - Intergenic
1001130611 5:169060607-169060629 ATTAGCTGGGAGTCTGCATCAGG + Intronic
1003693515 6:8378149-8378171 ACTAGCTGGCAGCCTTGACTGGG - Intergenic
1010454924 6:76043848-76043870 ATTTGATGGAAGCCTGCCCGAGG - Intronic
1013755533 6:113457260-113457282 GTTAGCTGGCAGCCAGGAAGTGG + Intergenic
1021700824 7:23317933-23317955 ATTAGCTGAGAGACAGCACGTGG - Intronic
1023486985 7:40698137-40698159 GTAAGATGGCAGCCTGCAAGTGG + Intronic
1034945179 7:155257562-155257584 ATTAGGAGGAAGCCTGCATGTGG - Intergenic
1039558322 8:38493003-38493025 ATTAGCTGGCCGGCTGGGCGTGG + Intergenic
1043286302 8:78535919-78535941 ATCACCTGGCAGCGTGCATGGGG - Intronic
1045626954 8:104064021-104064043 AATAGCTGGCAGCCAGCTAGTGG - Intronic
1048161485 8:132025559-132025581 ATTAGCTAACAGCCTGCCCCGGG + Intronic
1050191295 9:3029369-3029391 ATTAGGTTGCAGCCTACATGAGG + Intergenic
1050540803 9:6667842-6667864 ATTAGATGGCAGCATTCAGGTGG - Intergenic
1051164949 9:14251680-14251702 ATTAGCTGACCTCCTGCAGGAGG - Intronic
1051997253 9:23232998-23233020 ATAAGTTGGCAGCCAGCACCAGG + Intergenic
1060984737 9:127813538-127813560 AGTCACTGGCAGCCTGCACCTGG + Exonic
1188401241 X:29747509-29747531 ATGAGCTGGCACACTGCACAAGG - Intronic
1192487851 X:71545732-71545754 ATTAGCTGGCAACCTACATAAGG - Intronic
1200032163 X:153305604-153305626 ATTAGCCTGCAGGCTGCATGAGG + Intergenic