ID: 1088080539

View in Genome Browser
Species Human (GRCh38)
Location 11:105906650-105906672
Sequence CCAGCTAATACGTGGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088080533_1088080539 12 Left 1088080533 11:105906615-105906637 CCATCTTCTTAATGGCATAGCCC 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45
1088080531_1088080539 26 Left 1088080531 11:105906601-105906623 CCATCTCTAGATTTCCATCTTCT 0: 1
1: 0
2: 4
3: 47
4: 434
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45
1088080535_1088080539 -8 Left 1088080535 11:105906635-105906657 CCCTCGTGCAGGCTGCCAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45
1088080536_1088080539 -9 Left 1088080536 11:105906636-105906658 CCTCGTGCAGGCTGCCAGCTAAT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088080539 Original CRISPR CCAGCTAATACGTGGTAAGC TGG Intronic
901875155 1:12163250-12163272 CCAGCTAATACGGGGTACAGCGG - Intergenic
903734394 1:25521046-25521068 ACAGCCAATAAGTGGTCAGCTGG - Intergenic
903740926 1:25558035-25558057 CCAGCTAAGATGTGGTCAGGGGG - Intronic
1070056989 10:72945027-72945049 CCAGCTAAAACGTGGAAGGAGGG + Intronic
1071131391 10:82397710-82397732 CCAGGAAATATGTGGTAAGGAGG + Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1082933074 11:58629523-58629545 CCAGATCATTCCTGGTAAGCAGG - Intergenic
1085331325 11:75654192-75654214 ATAGTTAATACATGGTAAGCAGG + Intronic
1087557216 11:99736238-99736260 CAAGCTTATCTGTGGTAAGCAGG + Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1102422600 12:112815841-112815863 CCAGCTACATTGTGGTAAGCAGG - Intronic
1104239679 12:126975958-126975980 CCAGCAAAAAGGAGGTAAGCAGG + Intergenic
1108462251 13:50678305-50678327 CCATCCACTACTTGGTAAGCAGG - Intronic
1110366641 13:74694216-74694238 CCAAGTAGTAGGTGGTAAGCTGG - Intergenic
1117122581 14:52584270-52584292 CCAGGTTATATGTGCTAAGCTGG + Intronic
1137897669 16:52231812-52231834 ACAGGTAATAAGTGGTGAGCTGG - Intergenic
1138769504 16:59647353-59647375 GCAGCTAATACGTGGCATTCAGG + Intergenic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141151364 16:81566574-81566596 CCTGCCAAGACCTGGTAAGCAGG - Intronic
1154950141 18:21201976-21201998 CCATCTAATACTTTGGAAGCAGG - Intergenic
1158751004 18:60260844-60260866 CCAGCTAAGTCATGGTTAGCTGG - Intergenic
1162584036 19:11548160-11548182 CCAGCTGATGCGTGGCAGGCTGG + Intronic
1166980945 19:46631699-46631721 CCAGCTCAGAGGTGGGAAGCAGG + Intergenic
932195534 2:69779929-69779951 CCAGGTAATAGGGGGTAAGTCGG + Intronic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
1170509268 20:17060007-17060029 CAAGCTGATACCTGGTAACCAGG - Intergenic
1173378782 20:42516355-42516377 ACAGCTAATATGTGGTAAAAGGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1178551661 21:33544601-33544623 CCAGCTAATACGTTGTGAACAGG + Intronic
1179334627 21:40439057-40439079 ACAGCTAATGGGTGGTAAACAGG - Intronic
956353375 3:68363495-68363517 CCAGCTAATACATGGAAAATGGG + Intronic
956875632 3:73459876-73459898 CCAGCTAATACGTGGCAGGCAGG + Intronic
959648854 3:108732254-108732276 CCTGCTACTAGGTGGTCAGCTGG + Intergenic
966930463 3:184672425-184672447 CCATCCAACACGTGGTAAGTGGG - Intronic
969941203 4:10733438-10733460 CCATGTTATACTTGGTAAGCTGG + Intergenic
978158499 4:105517096-105517118 TAAGCTAAAAAGTGGTAAGCTGG - Intergenic
979764599 4:124448476-124448498 CCAGCCAATCCTGGGTAAGCAGG + Intergenic
981665011 4:147214491-147214513 ACAGCTAAGGCGTGGTAAGAGGG - Intergenic
995574169 5:113512462-113512484 TCAGCAAATACGAGATAAGCAGG - Intergenic
1007374635 6:41448017-41448039 CCAGCTACTACCTGGGAACCAGG + Intergenic
1007404470 6:41626140-41626162 TCAGCTTATAAATGGTAAGCTGG - Intergenic
1011712002 6:90064636-90064658 CCAGCTAATAAGTGGGTAGTAGG + Intronic
1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG + Intergenic
1016011240 6:139139439-139139461 ACAGCTAATACTTCGTAAGCTGG - Intronic
1023095358 7:36654726-36654748 CCAGCTAATTCCTCATAAGCAGG - Intronic
1041330134 8:56715364-56715386 ACAGCTATTAAGTGGTGAGCGGG - Intergenic
1043246090 8:78003524-78003546 CCACATAATACATGGTAAACCGG + Intergenic
1055591924 9:77825550-77825572 CCTGCTAATATGGAGTAAGCTGG - Intronic
1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG + Intergenic
1197883936 X:131198354-131198376 ACAGCTAATATGAGATAAGCTGG + Intergenic