ID: 1088081858

View in Genome Browser
Species Human (GRCh38)
Location 11:105926813-105926835
Sequence TAACCTCGCTGCTTTCCTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088081858 Original CRISPR TAACCTCGCTGCTTTCCTGA CGG Exonic
900920766 1:5668757-5668779 TAACCTCGGTGCTTACCTAAGGG - Intergenic
908415912 1:63913064-63913086 AAACCACACTGCATTCCTGAAGG - Intronic
909023678 1:70460166-70460188 TAGCCTGGCTGGTTTCCTCATGG + Intergenic
909419595 1:75449420-75449442 TAACCTAGATTCTTACCTGAGGG - Intronic
915058971 1:153163867-153163889 TAACCTTGCTGCTCTTCTGGAGG + Intergenic
917685123 1:177408027-177408049 TAACCTCTCTGCTTTCATGCTGG + Intergenic
918096076 1:181335230-181335252 CAACCAGGCAGCTTTCCTGAGGG - Intergenic
920995882 1:210990591-210990613 AAACCTAGCTGCATCCCTGAGGG + Intronic
921734284 1:218609259-218609281 TAACTTGGCTGCTTTCTTGCTGG - Intergenic
921858561 1:220015769-220015791 TTACCTTCTTGCTTTCCTGAAGG - Intronic
924625419 1:245693279-245693301 GAACCTCCATGCTTCCCTGAGGG - Intronic
1067151230 10:43736572-43736594 TAAGCTGGCTGCCTTCCTGGTGG + Intergenic
1069884601 10:71615780-71615802 TAACGTGGGTGCCTTCCTGATGG - Intronic
1072235310 10:93448507-93448529 TAAAGTCCTTGCTTTCCTGAAGG - Intronic
1073107540 10:101040926-101040948 TAACCTCTTTTCTTTCTTGAGGG + Exonic
1073854355 10:107657488-107657510 TATCCTTGCTGTTTTGCTGAAGG - Intergenic
1077237265 11:1487756-1487778 TACCCTGGCTGCTTTCCTGATGG - Intronic
1079732815 11:23957070-23957092 TAACCTAGGTGTTTCCCTGAAGG + Intergenic
1080412983 11:32043848-32043870 TTTCCTCTCTGCTTTCCTGCTGG - Intronic
1083590364 11:63890104-63890126 TCACCTAGCTTCTTCCCTGAAGG - Intronic
1087715798 11:101607277-101607299 ACACCTCGCTGCTTTCCTGCTGG + Intronic
1087901521 11:103646704-103646726 TAACATCGCTGGCTACCTGAGGG + Intergenic
1088081858 11:105926813-105926835 TAACCTCGCTGCTTTCCTGACGG + Exonic
1089155453 11:116398684-116398706 TAACCTCAGGGCTTTCATGAAGG - Intergenic
1092255671 12:6925777-6925799 TAACCTCCTTCCTTCCCTGAAGG + Intronic
1095419305 12:42008450-42008472 TAACCTCTCTGCTTTCACCAGGG - Intergenic
1100670061 12:96802255-96802277 TGCCCATGCTGCTTTCCTGAGGG + Intronic
1101819931 12:108175768-108175790 TATGCTGGCTGCTTCCCTGAAGG - Intronic
1102570497 12:113824389-113824411 CAACCTCGCTCTTTTCCTGGAGG - Intronic
1108446346 13:50512605-50512627 TCATCTCACTTCTTTCCTGAAGG - Intronic
1108799994 13:54083179-54083201 GAACCTGTCTGCTTTCCTAATGG + Intergenic
1109606895 13:64707810-64707832 TAACCTAGCAGGTTTCCTAACGG - Intergenic
1110511723 13:76358741-76358763 TAACCCCTGTGCTTTCCTTATGG + Intergenic
1111184247 13:84710845-84710867 AAACTTAGCTGTTTTCCTGATGG - Intergenic
1113020525 13:105880507-105880529 TAACATGGCTTCTTTCCTGATGG + Intergenic
1118492028 14:66270273-66270295 TAACCTGCCTGCATCCCTGAAGG - Intergenic
1118763094 14:68892525-68892547 CAACCTCCCTGCTTTGCTAAGGG + Intronic
1118975901 14:70676508-70676530 TAACCTGGCTGGTTACCTCATGG - Intergenic
1119130861 14:72171962-72171984 TAACCACACTGCTCTCCTGCAGG + Intronic
1128765691 15:70249805-70249827 TAACCTCTCTGGGTTTCTGATGG + Intergenic
1131392619 15:92061700-92061722 TCAACTCTCTGCTTTCCTGAGGG - Intronic
1131567651 15:93501346-93501368 GAACCTCTCTGTTTTCCAGATGG - Intergenic
1131683764 15:94750429-94750451 TCAGCTCACTGCTGTCCTGATGG + Intergenic
1132306982 15:100822788-100822810 TATCCTCTCTTCCTTCCTGAAGG + Intergenic
1134084718 16:11348564-11348586 TTACCTCCCTGCCTCCCTGATGG - Intronic
1135009595 16:18862952-18862974 TTACCTAACTGCTTTCCTTATGG + Intronic
1135316629 16:21451875-21451897 TTACCTAACTGCTTTCCTTATGG + Intergenic
1135369552 16:21884120-21884142 TTACCTAACTGCTTTCCTTATGG + Intergenic
1135442262 16:22487007-22487029 TTACCTAACTGCTTTCCTTATGG - Intronic
1136313299 16:29430582-29430604 TTACCTAACTGCTTTCCTTATGG + Intergenic
1136326742 16:29532352-29532374 TTACCTAACTGCTTTCCTTATGG + Intergenic
1136441433 16:30272336-30272358 TTACCTAACTGCTTTCCTTATGG + Intergenic
1139888224 16:70226066-70226088 TTACCTAACTGCTTTCCTTATGG + Intergenic
1139891299 16:70254711-70254733 CAAGCTCTCTGCTTTCCTGAGGG + Exonic
1143778928 17:9219322-9219344 TAACCAAGCTGCTATCCAGATGG + Intronic
1152419235 17:80183118-80183140 TAACCTTGCGGCTTTGCTGGAGG + Intronic
1152551444 17:81032376-81032398 GAACCTGACTGCTTGCCTGAAGG - Intergenic
1155052290 18:22159037-22159059 CAACCTCTCTGCTTTCTTGCTGG + Intergenic
1155178325 18:23321150-23321172 TAACCAAGCTGTTTTCCTCATGG - Intronic
1163304738 19:16471174-16471196 CAAGGTCGCTGCTTTCCTGGAGG - Intronic
1163627097 19:18396501-18396523 CAACCTCTCTGCCTTCCTGGAGG - Exonic
1165779115 19:38422050-38422072 TGACCTTGCTGATTTCCCGAGGG + Exonic
925428055 2:3767550-3767572 TATTTTTGCTGCTTTCCTGAGGG + Intronic
928291686 2:30044207-30044229 AAACCTTTCTGCTTTTCTGATGG + Intergenic
929236170 2:39607696-39607718 TAACCATGCTGCTTTCCTTTAGG + Intergenic
936971100 2:118177098-118177120 TCCCCTCCCTGCTGTCCTGATGG + Intergenic
937433458 2:121860502-121860524 CAACCACGCTGCCTTCCTTAAGG + Intergenic
941393016 2:164938351-164938373 TAACCACTCTGCTTTGCTCATGG + Intronic
941892270 2:170594872-170594894 TTTCCTCTCTACTTTCCTGAAGG + Intronic
946495983 2:220196012-220196034 TAACCTCCCAGCTTTGCTGCTGG + Intergenic
1170961183 20:21027184-21027206 TAACTTGTTTGCTTTCCTGAGGG - Intergenic
1172667124 20:36608011-36608033 TTACCTTCCTGCCTTCCTGAAGG + Intronic
1175754417 20:61520455-61520477 TAACCCCGATGCCTTCCTGGAGG + Intronic
1180975931 22:19848407-19848429 TGACCAAGCTGCTTTCCTGCTGG - Exonic
1182770368 22:32791358-32791380 TAACTTCGGTGCTTACCTCAAGG + Intronic
949587024 3:5451477-5451499 TAACATTGCTGCTGTCCTGATGG + Intergenic
950378000 3:12587786-12587808 TCACATCACTGCTTACCTGAAGG + Intronic
951824705 3:26855393-26855415 TACAGTCACTGCTTTCCTGAGGG + Intergenic
952186310 3:30973389-30973411 CATCCTGGCTGCTTTGCTGAGGG - Intergenic
958504118 3:94951645-94951667 AAACTTCTCTGCTTTCATGAAGG + Intergenic
963369034 3:144374254-144374276 TATGCTCGCTGCCTTCGTGATGG + Intergenic
964724135 3:159796496-159796518 TTACATCGCTGCTTTCCTCTGGG - Intronic
973614977 4:52669452-52669474 TCACCACCCTGCTTTCCTGATGG + Intergenic
975848656 4:78549709-78549731 TAACTTCTTTGATTTCCTGATGG - Intergenic
976824807 4:89249075-89249097 TATCCTCACTGCATTTCTGAAGG - Exonic
980319893 4:131257543-131257565 TACCCTCCTTGGTTTCCTGAAGG + Intergenic
983531249 4:168811936-168811958 TACCCTCGCCTGTTTCCTGAAGG + Intronic
988466518 5:31497196-31497218 TATCCTCTCTGCACTCCTGATGG - Intronic
996708388 5:126520133-126520155 GAACAGAGCTGCTTTCCTGAGGG + Intergenic
997635638 5:135402851-135402873 TAAACTAGCTGCTTTTCTCATGG - Intergenic
1001533645 5:172482767-172482789 TAGCCTGCCTGCTTGCCTGATGG + Intergenic
1005475874 6:26207305-26207327 TTACCTCCATGCTTTCCTGCTGG - Intergenic
1005509360 6:26498341-26498363 TCTCCTTGCTTCTTTCCTGAGGG - Intergenic
1008541479 6:52550154-52550176 TCACCTGGCTCCTTTCCTGCTGG + Intronic
1010746689 6:79570669-79570691 TAACCTGGCTGCATTCCTGAAGG + Intergenic
1014606664 6:123482854-123482876 TTAACATGCTGCTTTCCTGAGGG - Intronic
1018629188 6:165807471-165807493 TGTCCTCACTGCTTTCCTGTGGG - Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1023742584 7:43293885-43293907 TAATGTCGCTGCTTGTCTGATGG - Intronic
1024596399 7:50941174-50941196 TCATCTCTCTGCTTTCCTGGTGG - Intergenic
1036012808 8:4746750-4746772 TGACCTCGCTGCTGTAGTGAAGG - Intronic
1039770105 8:40677477-40677499 TAACGTCCCTGGTTTCCTCAAGG + Intronic
1043525172 8:81088722-81088744 TAAGCTAGCTTCTTTTCTGAAGG - Intronic
1045339510 8:101240481-101240503 TAGCCTAGGTGCCTTCCTGAGGG + Intergenic
1047288274 8:123506884-123506906 AAGGTTCGCTGCTTTCCTGAAGG + Intronic
1052202546 9:25800148-25800170 TAACCTGGCAGATTCCCTGAGGG + Intergenic
1052660080 9:31418011-31418033 TAAGCTAGCTGTTTCCCTGATGG - Intergenic
1056186316 9:84138356-84138378 TGACCCAGCTGCTTTCCTAAAGG - Intergenic
1057167147 9:92937895-92937917 TAATGTCGCTGCTGACCTGACGG - Intergenic
1057282964 9:93726136-93726158 GAACCTCTCTTCTTCCCTGAAGG + Intergenic
1058450399 9:105091114-105091136 GACCCTTGATGCTTTCCTGATGG + Intergenic
1059291023 9:113223691-113223713 TAAAATTGCTGCTTCCCTGAGGG - Intronic
1060669294 9:125454882-125454904 CAACATCTGTGCTTTCCTGAAGG - Intronic
1062580911 9:137228873-137228895 GGACCTGGCTGCTTTCCTGGCGG + Exonic
1185723899 X:2404121-2404143 TACACTTGCTGCTGTCCTGAAGG - Intronic
1195370111 X:104165449-104165471 TAAGTTCTATGCTTTCCTGAAGG + Intergenic
1196529106 X:116762304-116762326 TAATTTCCCTGCTTTCCTGTGGG - Intergenic
1197171191 X:123436264-123436286 TAATCTCTCTGCTTTCTTGATGG + Intronic
1197914753 X:131522451-131522473 TATCCTAGCTCCTTTCCTTAGGG - Intergenic
1198330107 X:135614932-135614954 CCACCTTGCTGCTTCCCTGATGG - Intergenic
1198362776 X:135912396-135912418 TCACCTTGCTGCTTCCTTGATGG - Exonic