ID: 1088081907

View in Genome Browser
Species Human (GRCh38)
Location 11:105927623-105927645
Sequence TTGTTCCGATGGAAGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088081907_1088081913 24 Left 1088081907 11:105927623-105927645 CCTTTGACCTTCCATCGGAACAA 0: 1
1: 0
2: 2
3: 3
4: 70
Right 1088081913 11:105927670-105927692 TTAGTGTTTGTTCCATTATGGGG 0: 1
1: 0
2: 0
3: 26
4: 235
1088081907_1088081912 23 Left 1088081907 11:105927623-105927645 CCTTTGACCTTCCATCGGAACAA 0: 1
1: 0
2: 2
3: 3
4: 70
Right 1088081912 11:105927669-105927691 TTTAGTGTTTGTTCCATTATGGG 0: 1
1: 0
2: 6
3: 29
4: 267
1088081907_1088081911 22 Left 1088081907 11:105927623-105927645 CCTTTGACCTTCCATCGGAACAA 0: 1
1: 0
2: 2
3: 3
4: 70
Right 1088081911 11:105927668-105927690 TTTTAGTGTTTGTTCCATTATGG 0: 1
1: 0
2: 3
3: 42
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088081907 Original CRISPR TTGTTCCGATGGAAGGTCAA AGG (reversed) Intronic
904812435 1:33172266-33172288 TGTTTCTGATGGAAGGACAAAGG + Intronic
905785598 1:40754563-40754585 TTGTTCTGAAGGAAGATAAATGG - Intronic
913085006 1:115428836-115428858 TTCTTCCAATGGAATGTGAATGG + Intergenic
915932232 1:160067936-160067958 CTGGTCCCAAGGAAGGTCAAGGG + Intronic
922686753 1:227644949-227644971 TTGTTCCAGAGGAAGGTCACAGG + Intronic
923120604 1:230986602-230986624 GTGTTCCGATGGATGGTAATTGG - Intronic
1067751829 10:48976827-48976849 TTGTCCCTGTGGAATGTCAATGG + Exonic
1075966355 10:126615113-126615135 TTATTCAGATGGAGGCTCAAAGG + Intronic
1078245281 11:9568835-9568857 TTGTTGCCAAGGAAGGTGAATGG + Intergenic
1079613334 11:22460218-22460240 TTGTTCCTAGTGAAGGCCAATGG + Intergenic
1080999735 11:37654540-37654562 TTGTTCTGCTGTATGGTCAACGG - Intergenic
1083520854 11:63311689-63311711 TTGTTCAAATTGAAGGGCAAAGG + Intronic
1085142495 11:74159421-74159443 TTGTTCCACTGGAAGGTCTTAGG - Intronic
1088081907 11:105927623-105927645 TTGTTCCGATGGAAGGTCAAAGG - Intronic
1091268381 11:134288355-134288377 TTGTTGCAAAGGAAGGTCAAAGG + Intronic
1097404318 12:59170895-59170917 TTGTTCCTATTGCAGGTCTAGGG - Intergenic
1105238127 13:18580672-18580694 TAGTTCTGATGGAAGGGAAAAGG - Intergenic
1105975377 13:25468500-25468522 CTGTTCCTAAGGAAGATCAAAGG + Intronic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111913221 13:94334790-94334812 GATTTCCGATGGAAGGTCCAGGG - Intronic
1111959273 13:94792010-94792032 TAGTTCCGATGGGAAGTCACGGG + Intergenic
1112223682 13:97516190-97516212 GTGTTCCTATGGAAGGTGATTGG - Intergenic
1113136716 13:107098674-107098696 TCTTTCTGATGGAAGATCAAAGG - Intergenic
1117986382 14:61389962-61389984 CTCTTCAGATGAAAGGTCAAAGG + Intronic
1118544197 14:66867012-66867034 TGGTTGTGATGAAAGGTCAAAGG - Intronic
1120746790 14:88159479-88159501 TAGAGACGATGGAAGGTCAAGGG - Intergenic
1121578531 14:95008693-95008715 CTGTTCCGATGCAAGGCCGACGG + Intergenic
1126450435 15:48802763-48802785 TTGTTTGTATTGAAGGTCAAAGG - Intronic
1126809517 15:52387162-52387184 CTTTCCAGATGGAAGGTCAAGGG + Intronic
1130011273 15:80154527-80154549 TTGTTCAGCTGGAAGGCCAAAGG - Intronic
1137297597 16:47111151-47111173 GTCTTCCAATGGAAGGTCACTGG + Intronic
1137615015 16:49841228-49841250 TTGTTCCGAAGGCAGGACAGTGG + Intronic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1144197186 17:12905770-12905792 TTGTCCTGATGGCAGGTCATGGG + Intronic
1150539668 17:66083986-66084008 TTGTTATGTTGGAAGGTGAAAGG + Intronic
1151799209 17:76367773-76367795 TTGCACCCATGGATGGTCAAAGG - Intronic
1154511515 18:15108498-15108520 TAGTTCTGATGGAAGGGAAAAGG - Intergenic
1155205040 18:23551321-23551343 TTGTTCAGCTTGAAGGTCATGGG - Intronic
1157774050 18:50376928-50376950 TTGTTCCACTAGAAGGTCATCGG + Intronic
1160530595 18:79560093-79560115 TTGGTGTGATGGAAGGTTAAGGG + Intergenic
1165393363 19:35550721-35550743 TGGTTGCTATGGAGGGTCAAGGG + Intronic
931166319 2:59752898-59752920 TTGTTCCACTGGAAGGTCAATGG + Intergenic
936000558 2:108824477-108824499 TTGTTCCACTGGAAGGTCTTCGG + Intronic
936959151 2:118055478-118055500 TTGTTCAGATGGTAGGGAAAAGG - Intergenic
937695508 2:124804235-124804257 TTTCTCCTAGGGAAGGTCAATGG + Intronic
938511086 2:131945217-131945239 TAGTTCTGATGGAAGGGAAAAGG - Intergenic
942256459 2:174104979-174105001 TTGTTCTAATGGAATTTCAATGG + Intronic
943527337 2:189033044-189033066 TTTTTCCTATGAAAGTTCAAAGG + Exonic
944327356 2:198422222-198422244 TTGTTGCTCTGAAAGGTCAAAGG + Intronic
945848425 2:214976194-214976216 TTTTCCCAATGGAAGGTCCAAGG - Intronic
1170545845 20:17435372-17435394 TAGTTGCGATAGAAGGTTAAAGG + Intronic
1176782110 21:13208949-13208971 TAGTTCTGATGGAAGGGAAAAGG - Intergenic
951646622 3:24899089-24899111 TGGTCCCAATGGAAGGTCAGGGG - Intergenic
953067540 3:39487853-39487875 CTGATTCGATGGAAGGGCAAAGG - Intronic
956376210 3:68616116-68616138 TTTTTTCCATGGAAGGTGAAGGG - Intergenic
957642221 3:82869780-82869802 GTGTTCCGTTCGAATGTCAAGGG - Intergenic
957823336 3:85407586-85407608 TTGCTCCGAAGGAAAGTTAATGG + Intronic
958738743 3:98042291-98042313 TTCTTCCCATCCAAGGTCAAAGG - Intergenic
959746618 3:109782612-109782634 ATGTTCCAAAGGAAAGTCAAAGG - Intergenic
960206219 3:114902999-114903021 TTATTCCAATGTGAGGTCAATGG + Intronic
963213273 3:142717555-142717577 TATGTCCGATGGAAGGTCTAGGG - Intergenic
967616744 3:191578663-191578685 TAATTCCAAAGGAAGGTCAAAGG - Intergenic
993732216 5:91435964-91435986 TTGTTCAGATTGAAGGAGAATGG + Intergenic
998880180 5:146637544-146637566 TTGTTCAGATGGAAGGCAGAAGG - Intronic
1008656251 6:53617064-53617086 TTGTTCCAAGGGCAGGACAAAGG + Intergenic
1017514468 6:155143626-155143648 TTGTTCCCATTGATGGTCAACGG + Intronic
1032424186 7:131807289-131807311 GTGTTAAGATGGAAGGTGAAAGG + Intergenic
1035929924 8:3768939-3768961 GTGTTCCGATGGAAGGTGAATGG + Intronic
1040725747 8:50379407-50379429 TTGTGCCGATGGGGGGTCAGGGG + Intronic
1047150834 8:122261040-122261062 TAATTCTGATGGAAGGTAAAGGG + Intergenic
1047760106 8:127948275-127948297 TTGTGCCCATGGTAGGTCCAGGG + Intergenic
1050172639 9:2838493-2838515 TTGCTACGATGGAAGTTAAAGGG - Exonic
1051333764 9:16048176-16048198 TTGCTCCAAAGGAAGCTCAAGGG - Intronic
1052034877 9:23669258-23669280 GTGTTCCGATGGATGTTCCAAGG + Intergenic
1055514752 9:77023323-77023345 TTATTCTGATGAAAGGTCAGAGG - Intergenic
1190928887 X:54932062-54932084 TGGTTGTGATGGAAGGACAAGGG + Intergenic