ID: 1088082106

View in Genome Browser
Species Human (GRCh38)
Location 11:105931021-105931043
Sequence CTGTATCAAGTGAATCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088082102_1088082106 28 Left 1088082102 11:105930970-105930992 CCAGTACTTCTGTAAAAATTAAA 0: 1
1: 0
2: 1
3: 45
4: 529
Right 1088082106 11:105931021-105931043 CTGTATCAAGTGAATCAGAGAGG 0: 1
1: 0
2: 0
3: 16
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088082106 Original CRISPR CTGTATCAAGTGAATCAGAG AGG Intronic
904395039 1:30214383-30214405 GTGTCTCAAGTAAACCAGAGGGG - Intergenic
905462383 1:38130160-38130182 CTGAATGCAGTGAGTCAGAGAGG + Intergenic
906102694 1:43273221-43273243 CTGTATCAAGTGGGTGTGAGCGG + Exonic
909220586 1:72955493-72955515 CTGTAACAAGTGCACCAGTGTGG + Intergenic
909310196 1:74136831-74136853 CAGTATAAAATGAATCAAAGTGG - Intronic
909365119 1:74811879-74811901 GTGTATGAAGGGAATCAGACTGG + Intergenic
911357046 1:96835470-96835492 CTGTATCATGTGATTAAGAGAGG + Intergenic
911786822 1:101960839-101960861 CTGTAAGAATTGAAGCAGAGTGG - Intronic
917214471 1:172663853-172663875 TTGGAACAAGAGAATCAGAGTGG + Intronic
917576437 1:176326159-176326181 CGGCATCAAATGATTCAGAGTGG + Intergenic
921747066 1:218751477-218751499 CTGTATCAAGTTACAAAGAGAGG - Intergenic
922209548 1:223477033-223477055 ATGTACCAAGTGAGGCAGAGAGG - Intergenic
923090035 1:230733326-230733348 CTGTATCATTTCAATCAGAAAGG - Intergenic
923512773 1:234666769-234666791 CTTTAACAAGTGAATCTGAGAGG - Intergenic
1062789001 10:289596-289618 CTGTGTCGAGTGCATAAGAGTGG - Intronic
1064852083 10:19719568-19719590 CTGTATCATGTGAATGAGTTTGG + Intronic
1065109049 10:22422211-22422233 AGGTGTCAAGTGACTCAGAGAGG + Intronic
1067398583 10:45948949-45948971 CTGCATGAATTGAATCATAGTGG - Intergenic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1067866905 10:49918043-49918065 CTGCATGAATTGAATCATAGTGG - Intronic
1068374149 10:56155906-56155928 CTGTATCTAGTTAATCTGATGGG + Intergenic
1071756478 10:88546935-88546957 CTGTACCATGTGAATGACAGGGG + Intronic
1072439743 10:95443499-95443521 CTGTACCTACTGAATCAGAATGG + Intronic
1074581557 10:114724196-114724218 CTGTAACAAGAGACTCACAGGGG + Intergenic
1074773960 10:116752749-116752771 CTTTTACAAGTGAATCAGAGAGG - Intergenic
1077747828 11:4927307-4927329 TTGTATCATGACAATCAGAGTGG - Intronic
1080113640 11:28597848-28597870 CAGTATGAAGTGAGTCAAAGGGG - Intergenic
1081902011 11:46636755-46636777 CTGTATCAACTAAATCACATAGG - Intronic
1087675463 11:101157005-101157027 CTGAAGTAATTGAATCAGAGAGG + Intergenic
1088082106 11:105931021-105931043 CTGTATCAAGTGAATCAGAGAGG + Intronic
1088086354 11:105985308-105985330 ATGTAGGAAGTGAATTAGAGGGG - Intergenic
1093233413 12:16576483-16576505 CTGCCTCAAGGAAATCAGAGAGG - Intronic
1096594817 12:52688204-52688226 CTGTCTGAAGGGAAGCAGAGAGG - Intergenic
1101617304 12:106350781-106350803 CAGAATCTAGTTAATCAGAGAGG + Intergenic
1102193967 12:111011296-111011318 TTGCATCAAAGGAATCAGAGTGG + Intergenic
1104392057 12:128399401-128399423 CTGTATCTATTGAAAGAGAGAGG - Intronic
1106476477 13:30102610-30102632 GTGTAGCAAATGGATCAGAGAGG - Intergenic
1106522580 13:30511002-30511024 ATGTACTAAGTGAACCAGAGTGG + Intronic
1111602845 13:90495554-90495576 CTGTATCAAGTTAATCTGATGGG + Intergenic
1113544024 13:111132360-111132382 CACTATCAAATGAATCAAAGGGG - Intronic
1115508772 14:34119276-34119298 CCAGATCTAGTGAATCAGAGAGG + Intronic
1120480881 14:85047610-85047632 TTGAATCAATTGAATCATAGGGG + Intergenic
1124453276 15:29818025-29818047 TTGTATCAAGTGGAGCACAGTGG - Intronic
1124937252 15:34184973-34184995 CTGTCTCAAGTGTTTCAAAGAGG - Intronic
1126369422 15:47929716-47929738 TAGTATCAAGTGAAGCAGAATGG - Intergenic
1128062930 15:64746690-64746712 GTTTGTCAAATGAATCAGAGAGG - Intronic
1128484005 15:68067128-68067150 CTGGAACAACTGAACCAGAGAGG - Intronic
1129040370 15:72681010-72681032 CAGTAACAAGTGAACCAGACAGG - Intronic
1131585715 15:93690645-93690667 CTATGTCAAGTGGATCAAAGGGG + Intergenic
1135644394 16:24148812-24148834 CTGGATCAAGTGAATGAGTGTGG - Intronic
1135644607 16:24150740-24150762 CTGGATCAAGAGAATGAGTGTGG - Intronic
1135829253 16:25759052-25759074 CTGTAGCCAGGGAAACAGAGGGG + Intronic
1137591080 16:49694363-49694385 CTGTGCCAAGAGAAACAGAGAGG + Intronic
1138620034 16:58203676-58203698 CCGTATAAAGTGAAAGAGAGAGG + Intergenic
1139025710 16:62815660-62815682 CTGAATCAAGTGAATCCAATTGG - Intergenic
1139082764 16:63544770-63544792 CTGTATCATGTGATTCAGGCAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142843991 17:2657601-2657623 CTGGACCAAGTGAATCAGAATGG - Intronic
1144139370 17:12333336-12333358 CTTCATAAAGTGAATTAGAGAGG + Intergenic
1150431280 17:65119529-65119551 ATTTATCAAGTGAACCACAGTGG - Intergenic
1153089587 18:1329068-1329090 CTGTATGAAGTCAATAAAAGAGG + Intergenic
1155153978 18:23143327-23143349 ATGTACCAGGTGAGTCAGAGAGG - Intronic
1155359252 18:24983658-24983680 CAGTATGAAGAGAATCTGAGAGG - Intergenic
1157078351 18:44493411-44493433 CTGAATCAAGTGAATCATGGGGG + Intergenic
1167845545 19:52161281-52161303 CTGTACCAAGTAAAACAGACTGG + Intronic
1168407857 19:56120360-56120382 CTGTGCCGAGTGGATCAGAGTGG - Intronic
926301070 2:11602982-11603004 CAGTAGCAAGTGGCTCAGAGAGG - Intronic
927330201 2:21853724-21853746 CTGTATAAAGTGTATCAGTCAGG - Intergenic
927990838 2:27445789-27445811 CTGTATCCTGAAAATCAGAGTGG + Exonic
928422703 2:31151432-31151454 CTGTATAAACTGAATCCAAGAGG + Intronic
930034727 2:47078368-47078390 CTGTACCAAGTCACTGAGAGTGG - Intronic
932627770 2:73312435-73312457 TTTTACCAAGTGGATCAGAGTGG + Intergenic
944006105 2:194908456-194908478 CTGTTTCAAGAGCACCAGAGTGG + Intergenic
946714410 2:222538467-222538489 CTGTATAAAATGCAACAGAGAGG - Intronic
1169190738 20:3657824-3657846 CTGTAACAAGCAAATCAGAGTGG - Intergenic
1171070136 20:22060502-22060524 TTGTACCAAGTGAATCAGATGGG + Intergenic
1175798316 20:61786025-61786047 CTGTGTCTGGTGAACCAGAGGGG - Intronic
1177003461 21:15641445-15641467 CTGTATGTAGTGAATGAGAGGGG - Intergenic
1177268811 21:18819637-18819659 TTGTAGCAAGTGAAGCAGAAGGG - Intergenic
1178162169 21:29930891-29930913 CTGTATCAAGGGAAACAAAAAGG - Intronic
1180918864 22:19508154-19508176 CTGTCTCCAGTGAAACAGACTGG - Intronic
954928281 3:54256864-54256886 TTGTATCCTGTTAATCAGAGAGG - Intronic
955834606 3:63041068-63041090 ATGTAGGAAGAGAATCAGAGGGG + Intergenic
956592828 3:70933366-70933388 CTGGCTCAGGTGAATCAGAGAGG - Intergenic
957786767 3:84892355-84892377 CTGTAGCAACTCTATCAGAGGGG - Intergenic
957911290 3:86622482-86622504 CTGTTGCAAGTGAACCAGAGAGG - Intergenic
959093195 3:101925825-101925847 CTCTATTAAGTGAATGAGGGGGG + Intergenic
963332891 3:143935546-143935568 CATTATCAAGGGAATCAGAAAGG + Intergenic
964055751 3:152454794-152454816 CAGTATCTAGGAAATCAGAGTGG - Intronic
965098838 3:164271469-164271491 CTATGGCAAGAGAATCAGAGAGG - Intergenic
965830842 3:172787355-172787377 CTGTCTCAAGAGAATGAGAGAGG - Intronic
975022969 4:69513733-69513755 CTGCTTCAAATAAATCAGAGAGG - Intronic
975854107 4:78604752-78604774 CTGTCTCATGTAAAACAGAGAGG - Intronic
982444291 4:155471984-155472006 CTGTACCAAGTGAAAAAGAGAGG + Intergenic
983567634 4:169171221-169171243 CTGTTTTCTGTGAATCAGAGAGG + Intronic
984613358 4:181867002-181867024 CTGTAGCAGGGGAATCAGTGTGG - Intergenic
988875848 5:35444754-35444776 CTGTATCTAGCCACTCAGAGGGG - Intergenic
992227031 5:74628973-74628995 CTGAATTAAGTAAATCAGATGGG + Exonic
993544692 5:89196810-89196832 CTTCATAAAATGAATCAGAGAGG + Intergenic
994159398 5:96538880-96538902 CAATATCAAATGACTCAGAGAGG + Intronic
996456824 5:123694040-123694062 CTGTATCTAGGGAACCAGATGGG + Intergenic
1002556598 5:180046415-180046437 CTAAATCAAATGAATCAAAGAGG - Intronic
1003773223 6:9331058-9331080 TTGTATCAAGCAAATAAGAGCGG - Intergenic
1004648011 6:17581234-17581256 CTGTATCTAGTTAATCTGGGGGG + Intergenic
1005431341 6:25761053-25761075 CTGTTTTGAGTGAATCAGACTGG + Intronic
1010378231 6:75199680-75199702 CTTTATCAACTGTATCTGAGTGG - Intronic
1014572383 6:123025486-123025508 ATGAAGCAAGTGAATCTGAGTGG + Intronic
1016473503 6:144400693-144400715 CTGTATCAAGAGAATGAATGCGG + Intronic
1017601204 6:156083515-156083537 ATGTCTCTAGTGAATCAGAGAGG - Intergenic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1031199254 7:118658425-118658447 ATGTATCAAGTGTAAGAGAGAGG + Intergenic
1032728841 7:134617543-134617565 CAGAATCAAGAGACTCAGAGAGG - Intergenic
1036386688 8:8287872-8287894 CTGGATCCAGGGAATTAGAGTGG + Intergenic
1039493013 8:37961902-37961924 CTGCATCAAGTGGAACTGAGGGG - Intergenic
1039668845 8:39572087-39572109 AAGTATCAAGAGAATTAGAGAGG - Intergenic
1040091758 8:43406149-43406171 CTGAATCAAGTGAACCTGATAGG - Intergenic
1045454723 8:102366434-102366456 CTGTATCCAGAAAAGCAGAGGGG - Intronic
1048701607 8:137097340-137097362 CTGTCTCAAATGAGTCAGAATGG + Intergenic
1052347273 9:27422432-27422454 CTATATCAACAGAATTAGAGAGG - Intronic
1057261862 9:93589021-93589043 CTCCATCAAGTGAAGAAGAGAGG + Intronic
1057624911 9:96668337-96668359 CTGTGTCAAGTGATTCTGAGGGG + Intergenic
1185724633 X:2409817-2409839 CAGAATCACTTGAATCAGAGAGG - Intronic
1187378816 X:18781530-18781552 CTGTATTTAGTGTTTCAGAGAGG + Intronic
1189856175 X:45227471-45227493 CTGTATGAAGTGTATGAGATGGG + Intergenic
1193042585 X:77019256-77019278 CAGAATCAAGAGAATCACAGAGG + Intergenic
1194693848 X:97020774-97020796 TTGTATCATGTTACTCAGAGTGG + Intronic
1195387774 X:104329390-104329412 CTGTTTCCAGTAAATCAGACAGG + Intergenic
1195459470 X:105107894-105107916 CTGTATCAAGGAAGACAGAGTGG - Intronic
1195756170 X:108201024-108201046 CTGTATCTAATGAACCAGAAAGG - Intronic
1198265931 X:135008762-135008784 CTGTATTCAGTGAATCCTAGTGG - Intergenic
1199449425 X:147962762-147962784 GTGTATCAAGTGTATCAGTCAGG + Intergenic