ID: 1088086259

View in Genome Browser
Species Human (GRCh38)
Location 11:105984267-105984289
Sequence GAGAAAATGGACAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088086259_1088086268 29 Left 1088086259 11:105984267-105984289 CCTGCCTCCTTGTCCATTTTCTC No data
Right 1088086268 11:105984319-105984341 TCATACATGATTTTGGCATTTGG No data
1088086259_1088086266 22 Left 1088086259 11:105984267-105984289 CCTGCCTCCTTGTCCATTTTCTC No data
Right 1088086266 11:105984312-105984334 CCCACATTCATACATGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088086259 Original CRISPR GAGAAAATGGACAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr