ID: 1088086518

View in Genome Browser
Species Human (GRCh38)
Location 11:105987262-105987284
Sequence TTTTCCTTCCAGGAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088086513_1088086518 -2 Left 1088086513 11:105987241-105987263 CCCATCAAAGATCAACCACAGTT No data
Right 1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG No data
1088086514_1088086518 -3 Left 1088086514 11:105987242-105987264 CCATCAAAGATCAACCACAGTTT No data
Right 1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088086518 Original CRISPR TTTTCCTTCCAGGAGATGGA AGG Intergenic
No off target data available for this crispr