ID: 1088089854

View in Genome Browser
Species Human (GRCh38)
Location 11:106024946-106024968
Sequence CATAGTTACCATTATTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088089849_1088089854 3 Left 1088089849 11:106024920-106024942 CCACAATCAATACATCCATCACC No data
Right 1088089854 11:106024946-106024968 CATAGTTACCATTATTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088089854 Original CRISPR CATAGTTACCATTATTTGGT GGG Intergenic
No off target data available for this crispr