ID: 1088092816

View in Genome Browser
Species Human (GRCh38)
Location 11:106063317-106063339
Sequence AAGCTTTTATAGGTTGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 3, 2: 11, 3: 35, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088092816_1088092820 -1 Left 1088092816 11:106063317-106063339 CCATGTTCAACCTATAAAAGCTT 0: 1
1: 3
2: 11
3: 35
4: 201
Right 1088092820 11:106063339-106063361 TGCTGGTCACACTGCTGGAGTGG 0: 1
1: 0
2: 2
3: 25
4: 236
1088092816_1088092819 -6 Left 1088092816 11:106063317-106063339 CCATGTTCAACCTATAAAAGCTT 0: 1
1: 3
2: 11
3: 35
4: 201
Right 1088092819 11:106063334-106063356 AAGCTTGCTGGTCACACTGCTGG 0: 1
1: 0
2: 3
3: 28
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088092816 Original CRISPR AAGCTTTTATAGGTTGAACA TGG (reversed) Intronic
906855146 1:49296287-49296309 AAGCTTGTAGAGGTGGAACTAGG + Intronic
908179273 1:61588069-61588091 GAGGTTTAATAGGTAGAACAAGG + Intergenic
908525818 1:64986465-64986487 AAGGTTTCATTGGTTGAAAAAGG - Intergenic
908972260 1:69850974-69850996 AAACATTTATAGTTTGAGCATGG + Intronic
909648087 1:77939468-77939490 CAGCCTTTATAGGTGTAACATGG + Intronic
910188677 1:84573267-84573289 GGGCTTTTATAGGCCGAACAGGG - Intronic
910353132 1:86322833-86322855 ATGCATTTATAAGTTGAGCAAGG - Intergenic
916340898 1:163733053-163733075 GAGCTTTTATAGGTGAAACTTGG - Intergenic
916628542 1:166586649-166586671 CTGCTGTTATAGGTTGAAAATGG - Intergenic
916857704 1:168767991-168768013 AAGCCTTTACAAGTTGAAGAGGG - Intergenic
917269008 1:173252968-173252990 AATCTTTTATAGTTTGACCATGG - Intergenic
918268503 1:182871519-182871541 AAGTTTCTGTAGGTTAAACATGG - Intronic
918376574 1:183915281-183915303 AATATTTTATAGGATTAACATGG + Intronic
918575509 1:186054456-186054478 GAGGTTTTGTTGGTTGAACAAGG + Intronic
921316336 1:213894935-213894957 CAGCTTTTAAAGGATGAAGAGGG - Intergenic
922086872 1:222357558-222357580 AAGGTTTTATTGGGTGAAAAGGG - Intergenic
923127452 1:231044759-231044781 AAGCTTTTATAGGGTGAATGAGG - Intergenic
924274143 1:242368234-242368256 AGGCTTTTATAGGGTGAATACGG - Intronic
1063247297 10:4235072-4235094 AAACTCTTATAGTTTGTACATGG - Intergenic
1067072515 10:43145255-43145277 AGACTTCTATAGGATGAACAAGG + Intronic
1067272131 10:44801725-44801747 AAGCTTTAAAAGGGTGAATATGG - Intergenic
1068198991 10:53758325-53758347 AAGCTTTTATAGGCTGAACATGG - Intergenic
1068911837 10:62386965-62386987 AATCTTGTGTAAGTTGAACATGG + Intronic
1068953532 10:62802231-62802253 TAGCTATTATAGGTTTAAAATGG - Intergenic
1070577696 10:77692037-77692059 GAGCTTGTATAGAATGAACATGG - Intergenic
1071780766 10:88841854-88841876 AGGCTTTTATAGGGTGAAAAAGG - Intronic
1071968816 10:90881680-90881702 AAGCTTTTATAGGTATATCATGG + Intronic
1072573538 10:96678969-96678991 AAGCTTTTATTAGTTGAATGTGG - Intronic
1073990512 10:109257367-109257389 AAGCTTTAAAAGATAGAACAAGG - Intergenic
1075345458 10:121678896-121678918 AAGCTTTTATGGGCTGAATGTGG + Intergenic
1075674065 10:124283622-124283644 AACCATTTAAAGGTTGAGCAGGG - Intergenic
1077878062 11:6324340-6324362 GAGCTTTTATAGGCTGAACATGG + Intergenic
1078713702 11:13819172-13819194 CAGCTTTTATAGGCTGAATGAGG + Intergenic
1081017298 11:37898332-37898354 AAGCTTTTATAGGATGGACCTGG - Intergenic
1084536407 11:69759888-69759910 AGGCATTTCTAGGTGGAACATGG + Intergenic
1086772182 11:90780201-90780223 AAGGTCTCTTAGGTTGAACATGG - Intergenic
1088092816 11:106063317-106063339 AAGCTTTTATAGGTTGAACATGG - Intronic
1088541673 11:110919922-110919944 AAGCCTTTATAGGTGAATCATGG + Intergenic
1089016505 11:115169532-115169554 AATCTTTTATCGTTTGGACAAGG - Exonic
1091633836 12:2182574-2182596 AAGCTTTTATAGGGAGAAGGTGG + Intronic
1092657559 12:10702959-10702981 CTGCTTTTATAGGTTAAAAAAGG + Intronic
1092673908 12:10895182-10895204 TAGCTTTTATAGGTTTTACATGG + Intronic
1093065609 12:14655078-14655100 GAGCTTTCATAGGTTGTACAAGG - Intronic
1096905620 12:54932718-54932740 AAGATTTTATTGGGTGAAAAGGG + Intergenic
1097931166 12:65188441-65188463 GAGCTTTTATAGGCTGAATGTGG + Intronic
1097969912 12:65622353-65622375 ATGCTTTTATAGGGTGAGCACGG + Intergenic
1098805409 12:75015937-75015959 AAGGTTTTATTGGGTGAAAAGGG + Intergenic
1099242504 12:80154492-80154514 GAGGTTTTATAGGACGAACATGG - Intergenic
1100937519 12:99686425-99686447 GAGCTTTTATTGGTTCAACATGG - Intronic
1103812540 12:123627315-123627337 AAACTTTTTTAGCTTGCACATGG - Intronic
1104825879 12:131709481-131709503 AAGCTTTTATAGACCCAACACGG + Intergenic
1105387131 13:19941472-19941494 GAGCTTTTATAGGCTGAAGATGG + Intergenic
1106686164 13:32061662-32061684 TATCTTTTACATGTTGAACAAGG - Intronic
1107513699 13:41108732-41108754 ATGATTTTTTAAGTTGAACAAGG - Intergenic
1108045363 13:46378935-46378957 CAGTTTTTATAGGGTGACCAAGG - Intronic
1109429167 13:62209636-62209658 AATCTTTTAGAGCTGGAACACGG + Intergenic
1110167223 13:72457862-72457884 AAGCATTCATAGGTTCAAGAAGG + Intergenic
1110794546 13:79621558-79621580 AGGCTTTTATAGGGTGAACATGG + Intergenic
1111255354 13:85660749-85660771 AAGCTTTTATAGGGTGAGCATGG + Intergenic
1112549872 13:100409414-100409436 AGGGTTTTATAGGGTGAAAAGGG + Intronic
1113273338 13:108700040-108700062 AAGCATTTATAGGCTGGGCATGG + Intronic
1114539964 14:23447779-23447801 AGGCTTTTACAGGAGGAACATGG + Intergenic
1115751440 14:36496466-36496488 AAACTTTTCTGGGTTGAACCAGG + Intronic
1115922285 14:38389202-38389224 TAGCATTTATTGGTTGATCATGG - Intergenic
1116382982 14:44295701-44295723 ATGCTTATCTAGGTTGATCAAGG - Intergenic
1117129946 14:52675983-52676005 CAGCTTTTAAAGGTTTAGCAAGG - Intronic
1117141217 14:52792176-52792198 AACCCTTTATTGGATGAACATGG + Intergenic
1119279091 14:73388656-73388678 AAGGTTTTATAGTTTGAAGGTGG - Intronic
1120463592 14:84827433-84827455 GAGCTTTTATAGGCTGAAGATGG - Intergenic
1124833617 15:33174103-33174125 AAGCTTATAGAGGATGAAGAAGG + Intronic
1126717571 15:51536376-51536398 AACCTTTTATATGTTTTACAGGG + Exonic
1130389685 15:83444655-83444677 AAGCTTTTCTAGGCTGGGCATGG - Intergenic
1131268553 15:90932967-90932989 GAGCTTTTACAGGTTGAAGATGG - Intronic
1131308195 15:91264408-91264430 AGGCTTTTATAGGTCGAACATGG + Intronic
1131868732 15:96739283-96739305 AGGCTTTTATGGGGTGAACACGG + Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138966849 16:62094895-62094917 AAATATTTATAGGTTTAACATGG + Intergenic
1139031999 16:62895423-62895445 AATCTGTTATGGTTTGAACATGG + Intergenic
1139167699 16:64588296-64588318 GAGCTTTAGTAGGCTGAACATGG - Intergenic
1139843897 16:69905111-69905133 AAGTCTTTAGAGGCTGAACACGG - Intronic
1144118906 17:12130298-12130320 AAGATTTTCTAGGTAGAAGAAGG + Intronic
1148726292 17:49793101-49793123 ATGCATTTACAGGCTGAACATGG - Intronic
1149458958 17:56811821-56811843 AAGCTGTTAAATGTTGAACTGGG - Intronic
1151549300 17:74812746-74812768 AAGCCTTGAAAGGTTGAATAGGG - Intronic
1153414135 18:4826342-4826364 AAACATTTACAGGTTGAAGAAGG + Intergenic
1155275155 18:24180337-24180359 AAGATTGTATATGTTGTACATGG - Intronic
1155385703 18:25275055-25275077 AATATTTTATAGGTTGGATAAGG - Intronic
1155448806 18:25942175-25942197 AACCTTTTTTGGGTAGAACATGG - Intergenic
1156219783 18:35039863-35039885 GACCTTTTATAGGGTGAAAAGGG - Intronic
1156818012 18:41335360-41335382 AAGCTTTTATGGGACTAACATGG - Intergenic
1157143759 18:45139167-45139189 AAGATATTAGAGGTTGAAAACGG - Intergenic
1157184323 18:45525176-45525198 AAATTTTTATAGGATGGACAAGG - Intronic
1157353188 18:46909536-46909558 AAGGTTTTATCGGTTGGGCATGG - Intronic
1158684840 18:59604156-59604178 AAGCTCTTATGGGGTGAAGAGGG - Intronic
1158743878 18:60175212-60175234 AGGCTTTTATTGGATGAACATGG - Intergenic
1159531941 18:69666078-69666100 GAGCTTTTCGAGGTTGAAAAAGG - Intronic
1159993548 18:74939955-74939977 TAGCTTTTTTAGGTAGAAAATGG + Intronic
1163615756 19:18327161-18327183 AATCTTTGAGAAGTTGAACAAGG - Intergenic
1163626704 19:18394258-18394280 AAGCTTTTCTAGGTTGGAAAAGG - Intronic
925551236 2:5077571-5077593 AGGCGTTTATAGGATGTACATGG - Intergenic
927145241 2:20161060-20161082 AGGCTTTTATAGGATGAAAAGGG - Intergenic
928016278 2:27660909-27660931 ATGCTATTATAGGCTTAACAGGG + Intronic
928417878 2:31111674-31111696 AAGCTTTAAAAGGCTGAAAAGGG - Intronic
928832444 2:35503559-35503581 AAGCTTTTAAAGCAAGAACATGG - Intergenic
928898940 2:36297201-36297223 AGGATTTTAGAGGATGAACAAGG - Intergenic
930466189 2:51752931-51752953 AAATTTTTTTAGATTGAACAAGG - Intergenic
936792514 2:116165955-116165977 AATCTTTCCTAGGTTGGACAAGG + Intergenic
939920807 2:148110502-148110524 AAGCTTCTAGAGATTCAACAGGG - Intronic
941325505 2:164109370-164109392 AAGCTTTTATTGGTGGAAGCAGG - Intergenic
941823439 2:169865857-169865879 AAGCTTTTACAGGCTGGGCACGG + Intronic
942258429 2:174131085-174131107 AATCTTCTATATGTTGATCAGGG - Intronic
944475844 2:200105156-200105178 ATGCTTTTATAGCTTGGAAAAGG - Intergenic
944629157 2:201605652-201605674 AAGCTATTATAGGGAGAAAATGG + Intronic
947145804 2:227063975-227063997 ATGCTTTTATTTGTTTAACAAGG + Intronic
947179092 2:227396457-227396479 ATGCTTCTATAGGTTGAAGCTGG + Intergenic
947892648 2:233639262-233639284 AAGTTTTTATAGTTTGCAGAGGG + Intronic
1168771376 20:419147-419169 AAGCATTTATCGGTGGAATAGGG + Intronic
1168865624 20:1083628-1083650 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1169007899 20:2224152-2224174 AAGTGTTTATGGATTGAACAGGG + Intergenic
1169615067 20:7432585-7432607 AGGCTTTTATAGAGTGAAAATGG + Intergenic
1170145151 20:13165300-13165322 ATGCTTTTATGAGTGGAACAAGG - Exonic
1171244101 20:23595755-23595777 AAACTTTTGTAAGCTGAACATGG + Intergenic
1172583875 20:36068837-36068859 AAGATTTTATAGGCTGGGCACGG - Intergenic
1174847073 20:53952799-53952821 AAGATTTTATAGGCCAAACATGG - Intronic
1174851415 20:53998738-53998760 AAGCTAGTATAATTTGAACAAGG + Intronic
1178791187 21:35701775-35701797 AAACTTATATAGGATGATCAAGG - Intronic
1179465863 21:41572222-41572244 GAGCTTTTATAGGCTGAACATGG + Intergenic
1182193941 22:28494577-28494599 AGGCTTTTATAGGATGAACAAGG - Intronic
1184932027 22:47688404-47688426 AAGCTTTTATAGGGTGAATGTGG + Intergenic
951634901 3:24763135-24763157 AAGCTTTTATAGGTTTCCCATGG - Intergenic
954990300 3:54835191-54835213 ATGCTTTTATAAGTTTTACATGG - Intronic
956019573 3:64919810-64919832 AAGCTTTTATAGGATGAACATGG - Intergenic
957455266 3:80434159-80434181 AAGCTTTACTACGATGAACATGG - Intergenic
960626258 3:119685139-119685161 AAGTTTTTATAGGTTGAGGATGG - Intergenic
962946493 3:140175789-140175811 AAGCTTTTCTGGGTTTAAAATGG + Intronic
964421015 3:156502704-156502726 CAACTTTTATAGTTTGAACATGG - Intronic
964897496 3:161615486-161615508 AAGCTTTTAAATGGTGAACTTGG - Intergenic
965240631 3:166192464-166192486 AATCTGTTATAGGTTGAAGTAGG - Intergenic
965431253 3:168591864-168591886 AAGCAATTATCTGTTGAACAAGG + Intergenic
965921524 3:173921745-173921767 AAGGTTTTATACGTAGAAGAAGG - Intronic
967190580 3:186981219-186981241 GAGCTTTTGTAGGCTGAACGTGG + Intronic
967570534 3:191022864-191022886 ATGTTTTTATAGGTTAAAGATGG + Intergenic
969903506 4:10371839-10371861 AAGATTTTATTGGGTGAAAAAGG + Intergenic
971795459 4:31221180-31221202 AAGCTTTTATAGGCTGAACATGG + Intergenic
974049064 4:56923535-56923557 AAGATTCTATAGCTTGAACCCGG - Intronic
974146509 4:57954238-57954260 GAGTTTTTATAGGCTGAACATGG + Intergenic
976010409 4:80480370-80480392 GGGCTTTTATAGGATGAAAAAGG + Intronic
979094439 4:116528666-116528688 GAGCTTTTAAAGTTTTAACAAGG + Intergenic
979232389 4:118360257-118360279 AAGATTTCACAGTTTGAACAGGG - Intergenic
979422809 4:120527170-120527192 GGGCTTTTATAGGCTGAACATGG + Intergenic
979958503 4:126987021-126987043 AGGTTTTTTTAGGTTGAACATGG + Intergenic
979973504 4:127166877-127166899 ATTGTTTTATAAGTTGAACAAGG - Intergenic
980420600 4:132555092-132555114 AACATTTTATAGGTTGGATATGG - Intergenic
980729478 4:136808722-136808744 AAGATTTTATAGCTATAACAAGG + Intergenic
982849317 4:160292815-160292837 AAGGTTTTATTGATTGAAAAAGG + Intergenic
983088385 4:163474596-163474618 AGGCTTTTATAGGGTGAATTTGG - Intergenic
983767705 4:171506444-171506466 AGGCTTTTATTAGTTGAAGAGGG + Intergenic
984722172 4:182983780-182983802 AAGCTTTTATAGACAGAACACGG + Intergenic
986108933 5:4692046-4692068 AGGCTTTTATAGGACAAACATGG + Intergenic
988101232 5:26681785-26681807 AAACTTTTATCAGTTCAACAGGG - Intergenic
988664742 5:33313325-33313347 AAGCTTTTATAGGCTTAACATGG - Intergenic
988706319 5:33729276-33729298 AAGCTTTTATAGAGTGAATGTGG + Intronic
990784344 5:59402521-59402543 AATCTTTGATAGGTTTAACATGG - Intronic
991064125 5:62407717-62407739 AGGCTTTTATAGGGTGAATGTGG + Intronic
991997122 5:72399085-72399107 AAGCTTTTAAAGGATGAATTAGG + Intergenic
992524958 5:77600119-77600141 AAACTTTCATAGGTCAAACATGG + Intronic
992879001 5:81086718-81086740 AAGCTTGTATCGATTGAACCGGG - Intronic
993191012 5:84681145-84681167 AAGGTTGTTTAGGCTGAACATGG + Intergenic
993581806 5:89672098-89672120 CAGCCTTTATAGGTAGAATATGG - Intergenic
994007329 5:94854261-94854283 AAGCTGTTAGAGGTTGATCCAGG - Intronic
994190578 5:96864783-96864805 AAGATTTGATAGGTTGAAAAGGG + Intronic
994986270 5:106937916-106937938 AAGCATTTATAAGGTTAACAAGG + Intergenic
995929053 5:117413590-117413612 AAACTTTTATAAAATGAACATGG - Intergenic
996467665 5:123822355-123822377 AAGCATTAATAGGTAGAGCAAGG - Intergenic
1000653624 5:163849126-163849148 AAGATTTTATAGGCAGAACTTGG + Intergenic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1001271240 5:170313439-170313461 GAGCTTTTATAGGCTGAACATGG + Intergenic
1003594322 6:7460911-7460933 AGGCTTTTACAGGGTGAACACGG + Intergenic
1007023159 6:38543087-38543109 AGGCTTGTACAGGTAGAACATGG - Intronic
1009549763 6:65074057-65074079 AAGTTATTATAAGATGAACAAGG - Intronic
1011354088 6:86455536-86455558 TAGCCTTGAAAGGTTGAACATGG - Intergenic
1011769062 6:90655374-90655396 AATCCTTTATATGTTGTACAAGG + Intergenic
1012881741 6:104799397-104799419 GAGCTTTTGTAGGCTGAATATGG - Intronic
1014538203 6:122642133-122642155 GGGCTTTTATAGTCTGAACATGG - Intronic
1014721643 6:124924450-124924472 ATGCTTTTATAGGGTAAAGATGG + Intergenic
1016578999 6:145607068-145607090 AGGCTTTTATAGGGTGAACATGG - Intronic
1016784826 6:147999272-147999294 GAGCTTCCATAGGCTGAACATGG + Intergenic
1018223271 6:161603425-161603447 AAGCTTTTATAGGATAAATTTGG - Intronic
1018293625 6:162319457-162319479 CAGCTATTATAGTTTGCACATGG - Intronic
1018363192 6:163093546-163093568 AAGCTTTTACAGCTGGAATATGG + Intronic
1020419777 7:7988933-7988955 AAGAATTTTTAAGTTGAACAAGG - Intronic
1021065324 7:16165872-16165894 AAGATTTTACAGGTTGAAAAGGG - Intronic
1021267828 7:18547001-18547023 TAACTTTTATAGGCTGAATAAGG - Intronic
1021297638 7:18928165-18928187 ATGCTGTAGTAGGTTGAACAGGG - Intronic
1022256786 7:28666332-28666354 AAGCTCTCATAAGCTGAACAGGG + Intronic
1024822693 7:53351971-53351993 AAGCTTTAATAGATGGGACACGG + Intergenic
1025204785 7:56985973-56985995 AAGGCTTTATTGGTTGAGCACGG + Intergenic
1025667153 7:63590962-63590984 AAGGCTTTATTGGTTGAGCACGG - Intergenic
1031219031 7:118940052-118940074 AGGTTTTTATAGAATGAACATGG - Intergenic
1033080378 7:138290993-138291015 AAGCATTTTTAGGTTGGGCATGG - Intergenic
1033971956 7:147052450-147052472 ATTCTTTTATTGGTGGAACAGGG + Intronic
1034963803 7:155378914-155378936 AAGGTTTTATAGCTTAAAGATGG + Intergenic
1035736877 8:1894874-1894896 AAGCTTTTTGTTGTTGAACAAGG + Intronic
1036138928 8:6188525-6188547 CAGCTTTTATAGGCCAAACATGG - Intergenic
1036290023 8:7479342-7479364 AGGCTTTTATAGGGTGAAAATGG + Intergenic
1036331453 8:7832181-7832203 AGGCTTTTATAGGGTGAAAATGG - Intergenic
1038936517 8:32257904-32257926 ATGGTTTTATATGTTAAACAGGG - Intronic
1040957934 8:52998734-52998756 CGGCTTTTATAAGGTGAACACGG - Intergenic
1040973702 8:53166057-53166079 TAGCTTGTATTTGTTGAACAAGG + Intergenic
1040988168 8:53318882-53318904 AGACTTTCATAGGATGAACAAGG - Intergenic
1041601504 8:59722562-59722584 AAGATTTCAAAGGTTTAACAAGG - Intergenic
1043348378 8:79327339-79327361 AAGTTTTTATAAGTGGAAGAGGG + Intergenic
1043554047 8:81409357-81409379 AAGTTCTTAAAGGTGGAACACGG + Intergenic
1044914760 8:97100661-97100683 AAGAATTTATAGGTTAAAAATGG + Intronic
1046293270 8:112190054-112190076 AAGATTTTAGAGGTTGGACTAGG + Intergenic
1046625584 8:116573456-116573478 AAGCTTCTATTGGTTGAAAATGG + Intergenic
1047650628 8:126916285-126916307 AGGCTTTTATAGGATGAATATGG - Intergenic
1048469162 8:134691834-134691856 TATCTTTTATAGCTTTAACATGG - Intronic
1048645888 8:136418625-136418647 AAGCCTTTATTGAGTGAACAGGG - Intergenic
1049294499 8:141824266-141824288 TAGCTTTTATTGGTTAAAAAGGG + Intergenic
1049966796 9:787283-787305 AAGCCTATTTAGGTTGTACATGG + Intergenic
1050111082 9:2216910-2216932 GAGCTTTTATAGGACAAACATGG - Intergenic
1052211365 9:25907386-25907408 AAGCTTTTATGTGTTGGCCATGG - Intergenic
1053520044 9:38768335-38768357 AAGCTTTTGTAGGTTGAGCAAGG - Intergenic
1054778402 9:69143519-69143541 ATTCTTTTATAGGCTGAACTTGG - Intronic
1055262855 9:74459109-74459131 AAGCTTTTATAGGCTGAGCAGGG - Intergenic
1055328850 9:75161136-75161158 AAACTGTTAGTGGTTGAACAAGG - Intergenic
1059610256 9:115884596-115884618 AAGATTATAGAGGTGGAACAGGG + Intergenic
1060310787 9:122459548-122459570 AAGCTTTTATTGGTTAAAAAGGG - Intergenic
1186427944 X:9479054-9479076 AAGCTTTCAGAGGGAGAACAGGG - Intronic
1187328665 X:18315778-18315800 AAGCTTTTAAAGGCAAAACAAGG - Intronic
1187847758 X:23558466-23558488 AAAAGTTTAAAGGTTGAACAAGG + Intergenic
1188927140 X:36057865-36057887 AAGCTTTTGTAGCCAGAACATGG + Intronic
1189000845 X:36943339-36943361 ATGTTTTTATAAATTGAACATGG + Intergenic
1189268513 X:39734364-39734386 GAGGTTTTGTAGGTTGCACAAGG - Intergenic
1189940840 X:46119015-46119037 AGGCTTTTATAGGGTGAATGTGG - Intergenic
1191190906 X:57666184-57666206 AGGTTTTTATAGGTAGAAAATGG - Intergenic
1191958196 X:66669350-66669372 AAGCTTTTATACATTGATCTGGG - Intergenic
1193016568 X:76740461-76740483 AAACTATTCTAGGTTAAACATGG - Intergenic
1193241832 X:79179584-79179606 AGGCTTTTATAGTTTGAATGTGG - Intergenic
1194130689 X:90078169-90078191 AAGTTGTTAAAGGTAGAACATGG + Intergenic
1194655171 X:96564509-96564531 AAGCCTTTCTAGCTTGACCAGGG - Intergenic
1194690004 X:96972931-96972953 AACCTTTCATAGTATGAACATGG + Intronic
1195579273 X:106483081-106483103 AAGCTTTTATATCTTGACAATGG - Intergenic
1196886216 X:120248348-120248370 AAGGTTTTATTGGCTGAAAATGG - Intergenic
1199482214 X:148310153-148310175 AAGGTTTTAAAGGTAAAACAAGG + Intergenic
1200374994 X:155770411-155770433 AATTTTTTTCAGGTTGAACATGG + Intronic
1200700979 Y:6402327-6402349 AAGCTTTGATAGTTTTAAAACGG - Intergenic
1201033133 Y:9762371-9762393 AAGCTTTGATAGTTTTAAAACGG + Intergenic
1202175788 Y:22097784-22097806 AAGCTTTGATAGTTTTAAAACGG - Intergenic
1202215573 Y:22488599-22488621 AAGCTTTGATAGTTTTAAAACGG + Intergenic