ID: 1088095744

View in Genome Browser
Species Human (GRCh38)
Location 11:106099389-106099411
Sequence GGGGATTGTCTCTCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088095737_1088095744 3 Left 1088095737 11:106099363-106099385 CCTGGGATCTCCTTTACCATGAT No data
Right 1088095744 11:106099389-106099411 GGGGATTGTCTCTCCTGTGTTGG No data
1088095741_1088095744 -7 Left 1088095741 11:106099373-106099395 CCTTTACCATGATCCTGGGGATT No data
Right 1088095744 11:106099389-106099411 GGGGATTGTCTCTCCTGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088095744 Original CRISPR GGGGATTGTCTCTCCTGTGT TGG Intergenic
No off target data available for this crispr