ID: 1088095811

View in Genome Browser
Species Human (GRCh38)
Location 11:106100196-106100218
Sequence CCAGTTTATCAGTTAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088095803_1088095811 28 Left 1088095803 11:106100145-106100167 CCTTCATAGTATTTGTGAATTTG No data
Right 1088095811 11:106100196-106100218 CCAGTTTATCAGTTAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088095811 Original CRISPR CCAGTTTATCAGTTAATGTC AGG Intergenic
No off target data available for this crispr