ID: 1088096863

View in Genome Browser
Species Human (GRCh38)
Location 11:106111106-106111128
Sequence GTTTGTGGATGATGATCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088096861_1088096863 -2 Left 1088096861 11:106111085-106111107 CCAAACAAACTGTTGCTCAGAGT No data
Right 1088096863 11:106111106-106111128 GTTTGTGGATGATGATCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088096863 Original CRISPR GTTTGTGGATGATGATCTAG TGG Intergenic
No off target data available for this crispr