ID: 1088098975

View in Genome Browser
Species Human (GRCh38)
Location 11:106132862-106132884
Sequence CAGCAGTCATCAAGACCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088098975_1088098982 29 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG No data
1088098975_1088098978 12 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098978 11:106132897-106132919 TGTTATTTCTGAACAAAATGTGG No data
1088098975_1088098981 25 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098981 11:106132910-106132932 CAAAATGTGGAAAAGGAAGGTGG No data
1088098975_1088098983 30 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098983 11:106132915-106132937 TGTGGAAAAGGAAGGTGGAAGGG No data
1088098975_1088098980 22 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098980 11:106132907-106132929 GAACAAAATGTGGAAAAGGAAGG No data
1088098975_1088098979 18 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098979 11:106132903-106132925 TTCTGAACAAAATGTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088098975 Original CRISPR CAGCAGTCATCAAGACCCCT GGG (reversed) Intergenic
No off target data available for this crispr