ID: 1088098977

View in Genome Browser
Species Human (GRCh38)
Location 11:106132885-106132907
Sequence CAGAAATAACAGAACAGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088098977_1088098984 10 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098984 11:106132918-106132940 GGAAAAGGAAGGTGGAAGGGTGG No data
1088098977_1088098980 -1 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098980 11:106132907-106132929 GAACAAAATGTGGAAAAGGAAGG No data
1088098977_1088098983 7 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098983 11:106132915-106132937 TGTGGAAAAGGAAGGTGGAAGGG No data
1088098977_1088098987 15 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098987 11:106132923-106132945 AGGAAGGTGGAAGGGTGGAGGGG No data
1088098977_1088098988 28 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098988 11:106132936-106132958 GGTGGAGGGGAAGCAACAGATGG No data
1088098977_1088098986 14 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098986 11:106132922-106132944 AAGGAAGGTGGAAGGGTGGAGGG No data
1088098977_1088098979 -5 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098979 11:106132903-106132925 TTCTGAACAAAATGTGGAAAAGG No data
1088098977_1088098982 6 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG No data
1088098977_1088098981 2 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098981 11:106132910-106132932 CAAAATGTGGAAAAGGAAGGTGG No data
1088098977_1088098985 13 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098985 11:106132921-106132943 AAAGGAAGGTGGAAGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088098977 Original CRISPR CAGAAATAACAGAACAGATT AGG (reversed) Intergenic
No off target data available for this crispr