ID: 1088098982

View in Genome Browser
Species Human (GRCh38)
Location 11:106132914-106132936
Sequence ATGTGGAAAAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088098975_1088098982 29 Left 1088098975 11:106132862-106132884 CCCAGGGGTCTTGATGACTGCTG No data
Right 1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG No data
1088098977_1088098982 6 Left 1088098977 11:106132885-106132907 CCTAATCTGTTCTGTTATTTCTG No data
Right 1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG No data
1088098976_1088098982 28 Left 1088098976 11:106132863-106132885 CCAGGGGTCTTGATGACTGCTGC No data
Right 1088098982 11:106132914-106132936 ATGTGGAAAAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088098982 Original CRISPR ATGTGGAAAAGGAAGGTGGA AGG Intergenic
No off target data available for this crispr