ID: 1088100372

View in Genome Browser
Species Human (GRCh38)
Location 11:106147796-106147818
Sequence ATGTTTCAGCTTAAGCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088100372_1088100376 19 Left 1088100372 11:106147796-106147818 CCTGATTGCTTAAGCTGAAACAT No data
Right 1088100376 11:106147838-106147860 CTGAAACATTGGCTCTACTTGGG No data
1088100372_1088100374 8 Left 1088100372 11:106147796-106147818 CCTGATTGCTTAAGCTGAAACAT No data
Right 1088100374 11:106147827-106147849 GGTCTCAGACACTGAAACATTGG No data
1088100372_1088100375 18 Left 1088100372 11:106147796-106147818 CCTGATTGCTTAAGCTGAAACAT No data
Right 1088100375 11:106147837-106147859 ACTGAAACATTGGCTCTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088100372 Original CRISPR ATGTTTCAGCTTAAGCAATC AGG (reversed) Intergenic
No off target data available for this crispr