ID: 1088100374 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:106147827-106147849 |
| Sequence | GGTCTCAGACACTGAAACAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088100372_1088100374 | 8 | Left | 1088100372 | 11:106147796-106147818 | CCTGATTGCTTAAGCTGAAACAT | No data | ||
| Right | 1088100374 | 11:106147827-106147849 | GGTCTCAGACACTGAAACATTGG | No data | ||||
| 1088100370_1088100374 | 18 | Left | 1088100370 | 11:106147786-106147808 | CCTCTTCCTGCCTGATTGCTTAA | No data | ||
| Right | 1088100374 | 11:106147827-106147849 | GGTCTCAGACACTGAAACATTGG | No data | ||||
| 1088100371_1088100374 | 12 | Left | 1088100371 | 11:106147792-106147814 | CCTGCCTGATTGCTTAAGCTGAA | No data | ||
| Right | 1088100374 | 11:106147827-106147849 | GGTCTCAGACACTGAAACATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088100374 | Original CRISPR | GGTCTCAGACACTGAAACAT TGG | Intergenic | ||
| No off target data available for this crispr | |||||