ID: 1088100374

View in Genome Browser
Species Human (GRCh38)
Location 11:106147827-106147849
Sequence GGTCTCAGACACTGAAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088100372_1088100374 8 Left 1088100372 11:106147796-106147818 CCTGATTGCTTAAGCTGAAACAT No data
Right 1088100374 11:106147827-106147849 GGTCTCAGACACTGAAACATTGG No data
1088100370_1088100374 18 Left 1088100370 11:106147786-106147808 CCTCTTCCTGCCTGATTGCTTAA No data
Right 1088100374 11:106147827-106147849 GGTCTCAGACACTGAAACATTGG No data
1088100371_1088100374 12 Left 1088100371 11:106147792-106147814 CCTGCCTGATTGCTTAAGCTGAA No data
Right 1088100374 11:106147827-106147849 GGTCTCAGACACTGAAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088100374 Original CRISPR GGTCTCAGACACTGAAACAT TGG Intergenic
No off target data available for this crispr