ID: 1088103815

View in Genome Browser
Species Human (GRCh38)
Location 11:106183577-106183599
Sequence ATGCCCTTTTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088103815_1088103817 2 Left 1088103815 11:106183577-106183599 CCTTCACTCTTCTAAAAGGGCAT No data
Right 1088103817 11:106183602-106183624 TTTTTTTGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088103815 Original CRISPR ATGCCCTTTTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr