ID: 1088103815 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:106183577-106183599 |
Sequence | ATGCCCTTTTAGAAGAGTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1088103815_1088103817 | 2 | Left | 1088103815 | 11:106183577-106183599 | CCTTCACTCTTCTAAAAGGGCAT | No data | ||
Right | 1088103817 | 11:106183602-106183624 | TTTTTTTGGTCCTTTTTCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1088103815 | Original CRISPR | ATGCCCTTTTAGAAGAGTGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |