ID: 1088103817

View in Genome Browser
Species Human (GRCh38)
Location 11:106183602-106183624
Sequence TTTTTTTGGTCCTTTTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088103812_1088103817 10 Left 1088103812 11:106183569-106183591 CCAGAAGGCCTTCACTCTTCTAA No data
Right 1088103817 11:106183602-106183624 TTTTTTTGGTCCTTTTTCCATGG No data
1088103815_1088103817 2 Left 1088103815 11:106183577-106183599 CCTTCACTCTTCTAAAAGGGCAT No data
Right 1088103817 11:106183602-106183624 TTTTTTTGGTCCTTTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088103817 Original CRISPR TTTTTTTGGTCCTTTTTCCA TGG Intergenic
No off target data available for this crispr