ID: 1088104394

View in Genome Browser
Species Human (GRCh38)
Location 11:106189638-106189660
Sequence ATGTCCTTATGAAAAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088104394_1088104396 2 Left 1088104394 11:106189638-106189660 CCTTCACTTTTTCATAAGGACAT No data
Right 1088104396 11:106189663-106189685 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088104394 Original CRISPR ATGTCCTTATGAAAAAGTGA AGG (reversed) Intergenic
No off target data available for this crispr