ID: 1088104396

View in Genome Browser
Species Human (GRCh38)
Location 11:106189663-106189685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 39, 1: 40, 2: 27, 3: 29, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088104394_1088104396 2 Left 1088104394 11:106189638-106189660 CCTTCACTTTTTCATAAGGACAT No data
Right 1088104396 11:106189663-106189685 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254
1088104392_1088104396 10 Left 1088104392 11:106189630-106189652 CCAGGAGGCCTTCACTTTTTCAT No data
Right 1088104396 11:106189663-106189685 TTTGTTAGGTCCTTTTTCCATGG 0: 39
1: 40
2: 27
3: 29
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088104396 Original CRISPR TTTGTTAGGTCCTTTTTCCA TGG Intergenic
900799395 1:4728019-4728041 TTTGTTAGGTCCTCTGCTCAAGG - Intronic
903678513 1:25081914-25081936 TGTGTGAAGTCCTTTTGCCATGG - Intergenic
903980733 1:27186112-27186134 TTTGATAGGTCCTTTTTCCATGG + Intergenic
905159351 1:36017921-36017943 TTTGTTAGTTTATTTTTCTATGG - Intronic
907211827 1:52830309-52830331 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
907511269 1:54962494-54962516 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
909209975 1:72810675-72810697 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
909275019 1:73672502-73672524 TTTGTTGTGTCCTTTTTTTAGGG - Intergenic
909576127 1:77178320-77178342 TTTGTTAGGTCCTTTTTCCATGG + Intronic
909825009 1:80116782-80116804 TTTGTTAGGTCCTTTTTCCTTGG - Intergenic
910609842 1:89128749-89128771 TTTGTTATTCCCTTTGTCCAAGG + Intronic
910809645 1:91223117-91223139 TTTTTTAGGTCCTTTTTCCATGG + Intergenic
911089196 1:94004320-94004342 TTTGTAAGTCCCTTCTTCCACGG + Intronic
911334635 1:96567184-96567206 TTTAATGGGTCCATTTTCCATGG + Intergenic
911754603 1:101538691-101538713 TTGGTTAAGACATTTTTCCAAGG - Intergenic
911792656 1:102038104-102038126 TTTGTTAACTAATTTTTCCAAGG + Intergenic
912034866 1:105300430-105300452 TTTGTTAGGTCATATTTTCCAGG + Intergenic
912172410 1:107116738-107116760 TTTGTCAGGGACTTTTGCCAAGG - Intergenic
912986220 1:114434673-114434695 TTTTCTATGTCCTTTTTACATGG + Intronic
913481365 1:119292634-119292656 ATTGTTACTTCCATTTTCCAGGG + Intergenic
916640558 1:166724427-166724449 TTTGTTAGGACCTTTTTCCATGG + Intergenic
917819971 1:178752774-178752796 TTTATTAAGTATTTTTTCCAAGG - Intronic
918465316 1:184815843-184815865 TTTGTTAGGTCCTTTTTCCATGG + Intronic
918643736 1:186876973-186876995 GTTCTAAGCTCCTTTTTCCAAGG - Intronic
918707643 1:187688111-187688133 TTTCTTAGGGCTATTTTCCAGGG - Intergenic
919162497 1:193849182-193849204 TTTGTTAGGACCTTGGTCCAGGG + Intergenic
919575313 1:199301572-199301594 TTCATTAGCTCCTTTTCCCAAGG - Intergenic
920157272 1:203964297-203964319 ATTGTTAGGCCCTTTTTCCATGG - Intergenic
921710345 1:218367279-218367301 TTTGCTAGGTCCTTACCCCATGG - Intronic
922069424 1:222176427-222176449 TTTGTTGTGTCTTTTTGCCAGGG - Intergenic
922270867 1:224032292-224032314 CTTGTTAGGTCCTGGTTCCTAGG + Intergenic
923580801 1:235210273-235210295 TTTGTGTGGACCTATTTCCATGG - Intronic
923635050 1:235687047-235687069 TTTGATTGGTCCTTTTTCAAAGG - Exonic
923847614 1:237753527-237753549 CTTGTTAGGAGGTTTTTCCAAGG - Intronic
1063322744 10:5066933-5066955 TTTGTTAAGTGCTTTTTCCATGG - Intronic
1063608394 10:7542690-7542712 TTTGTCAGGTCCTTCTTACAGGG - Intergenic
1063711893 10:8487344-8487366 TTTGTTAAGCACATTTTCCATGG + Intergenic
1065807214 10:29405299-29405321 TTTGTTAGGTTCTTCTTCCATGG - Intergenic
1066493165 10:35914612-35914634 TTTTTTTAGTCATTTTTCCAAGG + Intergenic
1066540322 10:36439482-36439504 TTTGTCATCTCCTTTTTACATGG - Intergenic
1067351841 10:45483238-45483260 TATGTTAGTTCCTTGTTCGATGG - Intronic
1067387009 10:45825723-45825745 TATTTTATGTCCTTTTGCCAAGG - Exonic
1067419119 10:46131528-46131550 TATTTTATGTCCTTTTGCCAAGG + Intergenic
1067447262 10:46358884-46358906 TATTTTATGTCCTTTTGCCAAGG + Intergenic
1067590117 10:47501883-47501905 TATTTTATGTCCTTTTGCCAAGG - Exonic
1067637239 10:48009978-48010000 TATTTTATGTCCTTTTGCCAAGG - Intergenic
1068348253 10:55812425-55812447 TTTTTTAGGTCCTTTTTTTGTGG - Intergenic
1068868890 10:61922672-61922694 ATTTTTAGGTCTTCTTTCCATGG - Intronic
1070041307 10:72783032-72783054 TGAGTTATTTCCTTTTTCCATGG - Intronic
1070133832 10:73674407-73674429 TATTTTATGTCCTTTTGCCAAGG - Exonic
1070239003 10:74659298-74659320 TTTTCTTGGTCATTTTTCCATGG + Intronic
1070351492 10:75597096-75597118 TTTGTTTGTTTGTTTTTCCAGGG + Intronic
1070357239 10:75652098-75652120 TTAGTCAGGTCCTCTTTCCTGGG + Intronic
1073134073 10:101210067-101210089 TTTACCAGGCCCTTTTTCCATGG - Intergenic
1074192173 10:111147568-111147590 CTTCTTAGGTACCTTTTCCAAGG + Intergenic
1077699886 11:4431581-4431603 TGTGTTAGGTCTTTCCTCCAAGG - Intergenic
1078680035 11:13466843-13466865 CTTGTAAGCTCCTTTTTTCAGGG + Intergenic
1080369046 11:31612867-31612889 TTTGTTAGTTTCATTTTCCTAGG + Intronic
1082698361 11:56398698-56398720 TTTATTAAGTTCTTTTTCCATGG - Intergenic
1083376659 11:62228853-62228875 TTTGTTTGGTCCTTTTTATGTGG + Intergenic
1086822738 11:91454891-91454913 TTTGTTAAGTACCTATTCCATGG - Intergenic
1087226901 11:95611397-95611419 TTTGTTAGGTCCTTTTTTCATGG - Intergenic
1087391164 11:97537142-97537164 GTTAATAGGTGCTTTTTCCAGGG + Intergenic
1087464788 11:98490682-98490704 TTTGTTAGGTCCTTTTCCCATGG - Intergenic
1087524700 11:99295492-99295514 TTTGTTAGGCTCTTTTTCCATGG - Intronic
1088103817 11:106183602-106183624 TTTTTTTGGTCCTTTTTCCATGG + Intergenic
1088104396 11:106189663-106189685 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1088322091 11:108564705-108564727 TTTGATACAACCTTTTTCCAGGG - Intronic
1089190469 11:116649623-116649645 TAAGTTAGGTGATTTTTCCAAGG + Intergenic
1091484834 12:875958-875980 TTTTTTAGTTCCTTTTTCTCAGG + Intronic
1091719663 12:2803536-2803558 TCTGTTAGGTCCATTTTCTAAGG + Exonic
1093356238 12:18171865-18171887 TTTGTTAGGTCCTTTTTCGATGG + Intronic
1093977384 12:25438161-25438183 GTTGTTCAGTGCTTTTTCCATGG + Intronic
1094239589 12:28206861-28206883 TTTGTTAGGTCCTTTTTCCACGG - Intronic
1094268298 12:28583723-28583745 GTTGTTGGTTTCTTTTTCCATGG + Intergenic
1094268882 12:28589325-28589347 TGTGTTATGTCCTCCTTCCAAGG - Intergenic
1095810499 12:46369691-46369713 TTTGTTTTGTGCTTTTTCCCTGG + Intronic
1096210539 12:49762129-49762151 TTTGTTAATTTTTTTTTCCAAGG + Intronic
1096935999 12:55277223-55277245 TGTGTTAGTTCATTTTTACACGG + Intergenic
1097254580 12:57663935-57663957 TTTGTTCGGTCCTTTTTCCATGG + Intergenic
1098004860 12:65985555-65985577 TTTGTTAGGTTCTTTTTTCATGG - Intergenic
1098502566 12:71210530-71210552 TTTATTAGGTCCTTTTTCCATGG + Intronic
1098854885 12:75641350-75641372 ATTGTGAGCTCCATTTTCCAAGG - Intergenic
1100722163 12:97370634-97370656 TTTCTTTTCTCCTTTTTCCAAGG + Intergenic
1101189411 12:102315886-102315908 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1101842079 12:108334918-108334940 ATTCTTATTTCCTTTTTCCAGGG + Intronic
1102362827 12:112303120-112303142 TATGAGAGGTCTTTTTTCCAGGG + Intronic
1103268605 12:119652654-119652676 TTTTTTAGGTCCCTTTTCTGTGG - Intergenic
1103678254 12:122673569-122673591 TTTGTTAAGTCTTCTTTTCAGGG + Intergenic
1106052508 13:26204731-26204753 TTTCTTAGGCCCTTCTTACATGG - Intronic
1106624388 13:31405603-31405625 TTTGTTAGGTCCGTTTTCCATGG + Intergenic
1107111463 13:36702469-36702491 TTTGTTAAGTCCTTTTTCCATGG - Intergenic
1107175341 13:37393513-37393535 TTTGTTAGTTTGTTTTTACAGGG + Intergenic
1107614608 13:42152597-42152619 TTTGTCATGTCATTTTCCCATGG + Intronic
1108221156 13:48233988-48234010 TTCTTTACCTCCTTTTTCCACGG + Intronic
1109211982 13:59545523-59545545 TTTCTTAGGTCTTTTTTCTTGGG - Intergenic
1110050160 13:70886943-70886965 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1110481581 13:75983698-75983720 TTTGTTAGGTCCTCTCAGCATGG - Intergenic
1110960107 13:81610643-81610665 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1111594605 13:90395637-90395659 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1111828095 13:93294456-93294478 TTTGTTTTGTCTTTTTTGCAGGG - Intronic
1112564427 13:100541001-100541023 TTTGTTTGTTTGTTTTTCCATGG + Intronic
1113646680 13:112002386-112002408 TTTGTCAGGTGCCCTTTCCAGGG + Intergenic
1114335125 14:21681187-21681209 TTTGTTAGGTCATTTTTCTGTGG + Intergenic
1114912218 14:27214538-27214560 TTTGTCAAGTCCTTTTTCCATGG - Intergenic
1114919708 14:27311418-27311440 TTTGTTGCATCCTTTTTCCATGG + Intergenic
1115252239 14:31361587-31361609 ATTTTTAGGTACTTTTTCCAGGG - Intronic
1115339561 14:32278163-32278185 TTTGTTAGGGCCTTTTGTCAGGG + Intergenic
1116576585 14:46583030-46583052 TTTGTTAGTTCCTTTTTCTGTGG - Intergenic
1116725622 14:48558366-48558388 TTTGTTAGGTCCTTTATCCATGG - Intergenic
1118117193 14:62793308-62793330 TTTCTTCTGTCCTTTTTTCATGG - Intronic
1118418821 14:65576190-65576212 TTTGTTTGTTTCTTTTTCAATGG + Intronic
1120033516 14:79669493-79669515 TTTGTGAGTTTCTATTTCCAAGG + Intronic
1120232147 14:81851463-81851485 TTTGTTAGGTCCTAGTTCCATGG - Intergenic
1121268137 14:92617945-92617967 TTTATTAGGTCCTTTTTCCATGG - Intronic
1125630809 15:41145557-41145579 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1129157160 15:73725537-73725559 TTTGTGAAGTCCTTTTTGCCAGG - Intergenic
1129260282 15:74363007-74363029 TTTGTTAGGTCCTTTTTCCATGG + Intronic
1130556769 15:84928281-84928303 TTTGTTAGGTGCTTTTCCTCTGG - Intronic
1130780231 15:87029452-87029474 TTTCTTAGATCCTCTTTCAAAGG + Intergenic
1132205348 15:99982678-99982700 CTTGTTTGGTCCTTTTGTCAAGG + Intronic
1132278369 15:100590495-100590517 TTTGTTAGGTCCTTTTTCCATGG + Intronic
1134214972 16:12310249-12310271 ATTGTTACATCCTTTTTTCAGGG - Intronic
1134435394 16:14251992-14252014 TGTGTTAGGTCCATTTTGCAGGG - Exonic
1135043489 16:19135853-19135875 TTTGTGCCGTCATTTTTCCAAGG + Intronic
1137730482 16:50686108-50686130 TTTTTTAGGTCCTCTGTGCAAGG - Intergenic
1139249740 16:65483279-65483301 TTTGTTACATCCATTTTGCAAGG - Intergenic
1139274817 16:65717731-65717753 TTTGCTTGCTCCTTTTTCAAAGG + Intergenic
1144031406 17:11326370-11326392 TTTGTTCACTCCTTCTTCCAGGG + Intronic
1144426681 17:15149514-15149536 TTTGTTAGGTCCTATTTCCATGG + Intergenic
1144449773 17:15366853-15366875 TTTGTTACTTCCTTTTTACTTGG - Intergenic
1148508439 17:48147025-48147047 TCTGTTAGGAGCTTTATCCAGGG - Intronic
1149448909 17:56734237-56734259 TTTATTAGCTGTTTTTTCCAGGG + Intergenic
1149501290 17:57154528-57154550 ATTGCTGGGTCCTATTTCCAGGG + Intergenic
1151544758 17:74785969-74785991 TTTGTTAGATCTTTTTTCTGTGG - Intronic
1152033367 17:77857219-77857241 TTTCTTAGGTCCTGTTTACAAGG + Intergenic
1203170383 17_GL000205v2_random:143178-143200 TGTGTGAGGTGATTTTTCCAAGG + Intergenic
1153049523 18:888255-888277 TTTGTAAGCTCTTGTTTCCAGGG + Intergenic
1153079139 18:1200415-1200437 TTTGTTTGTTAATTTTTCCAAGG + Intergenic
1154365684 18:13706606-13706628 TTTGTTAGGTCCTTTTTTCACGG + Intronic
1154488572 18:14900593-14900615 TTTATTCTCTCCTTTTTCCATGG + Intergenic
1154953372 18:21231321-21231343 TTTGATATATCCTTTCTCCACGG - Intergenic
1155632437 18:27908829-27908851 TTTGTTGGCCCATTTTTCCAAGG + Intergenic
1155803423 18:30137269-30137291 TTTGTTATGTCCTTTTTCCATGG - Intergenic
1156261853 18:35451833-35451855 TTTGTTATGTCGTTTTTTTAAGG - Intronic
1156524187 18:37750838-37750860 TTTGTTGGGTGCCTTTTCCGTGG - Intergenic
1157013301 18:43678829-43678851 TTTGTTAGGTCCCTTTTCCATGG - Intergenic
1157697727 18:49736516-49736538 TTTGTGGGGTCCTTTTCACAGGG + Intergenic
1158727847 18:59990862-59990884 TTTGTTATCCCCATTTTCCAGGG - Intergenic
1159249954 18:65862914-65862936 TTGGGTAGGTACTGTTTCCAGGG + Exonic
1159357083 18:67350159-67350181 ATTATTAGGTCATATTTCCAAGG - Intergenic
1160262927 18:77312413-77312435 TTTGTGAGGTCCTTTTTCCATGG - Intergenic
1164074663 19:21803132-21803154 GTTGTTAGGTGCTTTTTCTGAGG + Intergenic
1164461340 19:28451413-28451435 TTTGTTAGGTCTTTTTTCCATGG + Intergenic
1165839353 19:38778375-38778397 TTTGTTTGGTCTTTTTTTGATGG - Intergenic
1167430009 19:49448739-49448761 TTTCATAGGTCCTTATTCCCCGG + Intronic
925569428 2:5293187-5293209 TTTGTAAGCTCTGTTTTCCACGG - Intergenic
926545081 2:14229881-14229903 TTTGTCAGGGCCTCTGTCCAAGG + Intergenic
927439807 2:23105484-23105506 TTTGTTACGTAATTTGTCCAAGG - Intergenic
928032501 2:27793775-27793797 TTTGTTATGTCCTTTTTTTCAGG + Intronic
928266216 2:29814093-29814115 TTTGTTATTTTCTTCTTCCAGGG - Intronic
928382640 2:30832953-30832975 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
929848813 2:45561993-45562015 TTTGTTAGTTTATTTTTGCAAGG + Intronic
931055887 2:58470756-58470778 TTTTTAAGGTTCCTTTTCCATGG + Intergenic
933077737 2:77950877-77950899 TTCATTAGGTTCTTTTTCCATGG - Intergenic
933226578 2:79755768-79755790 TTAGTTAGGTCTCTTTGCCATGG + Intronic
933821890 2:86120449-86120471 ATTATTAGGTAATTTTTCCAGGG + Intronic
935498965 2:103815151-103815173 TGTGTAAGGTCTTTCTTCCATGG - Intergenic
936492720 2:112986407-112986429 TGTGTTAGGTCGTTCTTTCATGG - Intergenic
936598176 2:113869364-113869386 TTTGTTAAGTACTTACTCCAGGG - Intergenic
937796769 2:126032351-126032373 TTTGTTTGGCACTTTTTACAGGG - Intergenic
938601209 2:132842103-132842125 GTTTTTAGGACCTTTTTCAATGG + Intronic
939570693 2:143836975-143836997 TTTGTTTGTTCTTATTTCCAGGG + Intergenic
940569298 2:155409939-155409961 TTTGTTAGGTCCATTTTCCATGG + Intergenic
940951300 2:159678241-159678263 GTTATTAGGTTCTTTTTCAATGG - Intergenic
942174927 2:173324286-173324308 TTGTTTAGCTCCTTTATCCATGG + Intergenic
942399444 2:175586038-175586060 TTTGATAGGTTATTTCTCCAAGG + Intergenic
943235183 2:185308730-185308752 TTTGATAGGCTCTTTTTCCCAGG + Intergenic
943295502 2:186133061-186133083 TGTGTTTGATTCTTTTTCCATGG - Intergenic
943770267 2:191708964-191708986 TGTGTTGGGTCCTTTTTGAAAGG + Intergenic
944903801 2:204242760-204242782 ATTCTTTGCTCCTTTTTCCAGGG - Intergenic
945032393 2:205678147-205678169 TTCTTTAGGTTCTTTTTCCAAGG + Intergenic
945251000 2:207766910-207766932 TTTGTTTGGTAGTTTTGCCAAGG - Exonic
946701153 2:222415476-222415498 TTTGATAGGACTTTGTTCCATGG - Intergenic
947207558 2:227675783-227675805 TTTGTTATATCCTTTATCAAGGG - Intergenic
949082695 2:242117391-242117413 CTTGTTAGGTCCTGGTTCCTAGG - Intergenic
1168829945 20:840394-840416 TTTGATAGGCCATTTTTTCATGG - Intronic
1169729404 20:8770472-8770494 TTAGTAAGTTCATTTTTCCAAGG + Intronic
1170003870 20:11645414-11645436 TTTTTTAGGGCTTTTTTGCAAGG + Intergenic
1170677803 20:18498546-18498568 TTTGTTAGGTCCTTTTACCATGG + Intergenic
1171318502 20:24217895-24217917 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1171721763 20:28570325-28570347 TTTGATAGTCCCTTTTTCCATGG + Intergenic
1171756297 20:29113174-29113196 TTTGACAGGTAATTTTTCCATGG - Intergenic
1171785955 20:29464719-29464741 TTTGATAGGTCCTTTTTCCATGG + Intergenic
1171862286 20:30412253-30412275 TTTGATAGGTCCTTTTTCCATGG - Intergenic
1173699111 20:45051466-45051488 TTAGTGAGTTCCTTTTTTCATGG + Intronic
1174703442 20:52632402-52632424 TTTGTCAGCTCCTGTTTCAATGG - Intergenic
1176326374 21:5505009-5505031 TGTGTGAGGTGATTTTTCCAAGG + Intergenic
1176401383 21:6315942-6315964 TGTGTGAGGTGATTTTTCCAAGG - Intergenic
1176435774 21:6673162-6673184 TGTGTGAGGTGATTTTTCCAAGG + Intergenic
1176460036 21:7000232-7000254 TGTGTGAGGTGATTTTTCCAAGG + Intergenic
1176483597 21:7382010-7382032 TGTGTGAGGTGATTTTTCCAAGG + Intergenic
1177534069 21:22401718-22401740 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1177934976 21:27333913-27333935 TCTGTTAAGTCCATTTTCTAAGG - Intergenic
1180295319 22:10929012-10929034 TTTGATAGTTCCTTTTTCCATGG + Intergenic
1180413352 22:12637032-12637054 TTTGATAGGTCCTTTTTCCATGG - Intergenic
1183052948 22:35279497-35279519 TTTATCAGTTCCTTCTTCCATGG + Intronic
1184618701 22:45656650-45656672 TTTGTTAGGTCCTTTTTGCATGG + Intergenic
1184933024 22:47695502-47695524 TTTTTTAGGTCCTGTTGTCATGG - Intergenic
949639389 3:6018141-6018163 TATGATAGGTCTTTCTTCCAGGG + Intergenic
949773956 3:7610573-7610595 TTTGTTAGGTGAATTATCCATGG - Intronic
950604778 3:14068907-14068929 TTTGTTAGGTCCTTTTTCCATGG - Intronic
951013970 3:17709027-17709049 TCTGTTAGGCCCTTTTTTCTTGG + Intronic
951250338 3:20386978-20387000 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
951405529 3:22292455-22292477 TTTGGTAAGTTCTTTTTACAGGG + Intronic
951678956 3:25274549-25274571 TGTCTTAGGTCCCCTTTCCAGGG - Intronic
951841562 3:27039438-27039460 TTTGTTAGGTCCTTTTTCCGTGG - Intergenic
952120450 3:30236889-30236911 TTGCTTGGGTCCTTCTTCCAGGG - Intergenic
952152681 3:30608964-30608986 TTAGTTAGGTTCTGTTTACAAGG + Intronic
952285010 3:31960061-31960083 TTTGGAAGGACATTTTTCCATGG - Intronic
952669995 3:35954902-35954924 TTTCTCAGTTGCTTTTTCCAAGG + Intergenic
955751004 3:62185395-62185417 TTTGTTAGGTGCAGTTTACAAGG + Intronic
955883041 3:63568074-63568096 TTTCTAAGTTCTTTTTTCCATGG - Intronic
957603444 3:82368565-82368587 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
957750865 3:84413558-84413580 TTCGTTAGGTCCTTTTTCCATGG + Intergenic
957774681 3:84741845-84741867 TTCATTAGGTACTTTTTCTAAGG + Intergenic
958765368 3:98361008-98361030 GATGTGAGGCCCTTTTTCCAGGG - Intergenic
959518948 3:107303972-107303994 TTTGTTAGGTCCTTCTATCAGGG + Intergenic
959523685 3:107350419-107350441 TTTGATAAATCCTTTTTCTAAGG + Intergenic
959568003 3:107852491-107852513 TTTCTTTGATCCTTCTTCCATGG + Intergenic
960206789 3:114911569-114911591 TCTGTTTGGTCCTTTTTTTATGG - Intronic
960593710 3:119389624-119389646 TCTGTGAGGCCCTTTTTCAATGG + Intronic
961596266 3:128020226-128020248 TATGTTATGTCCTTTTTCCATGG + Intergenic
961853643 3:129847106-129847128 TTTGTAAGGTCCTGTTTCTTTGG - Intronic
961946655 3:130697379-130697401 TTTCTTAGGTACTATTTGCATGG + Intronic
962257405 3:133881943-133881965 TTTATTATGTCATATTTCCATGG + Intronic
963013182 3:140794667-140794689 TTTGGTATTTCCTTTTTCCCAGG - Intergenic
963143081 3:141964159-141964181 ATTGTGAGGTCCTGTTTCTATGG - Intronic
963576627 3:147068431-147068453 TTTGTTAGGTCCTTTTTGCATGG + Intergenic
964686910 3:159405265-159405287 TTGGTGAGGTCCTGTTTCCCTGG - Intronic
964934925 3:162072361-162072383 TTTGTTAGGTACTTGGTCCTGGG + Intergenic
966261201 3:177981521-177981543 GTTGTTAGATTCATTTTCCAAGG + Intergenic
966536205 3:181037127-181037149 TTTGTTAGGTCCTTTTTTCATGG - Intergenic
968415125 4:425146-425168 TTTTATGGGTCCTTTTTCAAAGG - Intergenic
970403195 4:15737483-15737505 TTTCTTAGCTGCTTTTGCCAGGG - Intronic
971213442 4:24641717-24641739 CTTGTTAGGTCCTTTTTCCATGG - Intergenic
971719654 4:30229282-30229304 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
972810191 4:42576116-42576138 TCTCTTGGGTACTTTTTCCAGGG - Intronic
972819193 4:42680029-42680051 TTTTTTGGGTCCTTTTTCCATGG + Intergenic
973211512 4:47620440-47620462 TTTGTTAGTTGCTTTTCTCATGG - Intronic
973813871 4:54600225-54600247 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
974649359 4:64734218-64734240 TTTGTTAGGTCCTTTGTCCATGG + Intergenic
974769936 4:66399942-66399964 TTGGTGAGGTCATTTTTCCCTGG + Intergenic
974918682 4:68209219-68209241 TTTGTTGAGTTCTTTTTTCAGGG - Intergenic
975140877 4:70917081-70917103 TTTGTTAGGTCCTTTTTCCAAGG - Intronic
975445985 4:74466161-74466183 TTGGCTAGGGCCTTATTCCAGGG + Intergenic
975854536 4:78609448-78609470 TTTATCAGTTCCTTTTCCCAAGG - Intronic
977560034 4:98523001-98523023 TTAGTTAGGTATTTTTTACAAGG + Intronic
979124410 4:116949201-116949223 TTTGTGAGTTCCTGTTTCCTTGG + Intergenic
979143486 4:117209312-117209334 TTTTTTAGTTGCTTTTTCAAAGG + Intergenic
979170124 4:117591188-117591210 TTTGTTAGTTACTTTTTCCTTGG - Intergenic
979218354 4:118193101-118193123 TTTGTTAGGTCCATTTTCCAGGG - Intronic
980302023 4:131007953-131007975 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
980432166 4:132716010-132716032 TTTCTTAGTTCCATTTTCTAAGG + Intergenic
980937016 4:139235222-139235244 TTTGTTAGGTCCTTTTTCTGTGG - Intergenic
981005558 4:139871470-139871492 TTTCTTTGGACCTATTTCCAGGG + Intronic
981010320 4:139918597-139918619 TTTGTTTCTTCCTTTTTCCTTGG + Intronic
981233942 4:142392607-142392629 TTTGTTAGGTCTATTTTCCATGG + Intronic
981619297 4:146676005-146676027 TGTGTTAAGTCCTTTTTTAAAGG + Intergenic
982194917 4:152901860-152901882 TGTGTTAGATCCTTGTCCCAAGG + Intronic
985004097 4:185515668-185515690 GCTGTTTGGTCCTTTTCCCAAGG - Intronic
985209450 4:187576783-187576805 ATTATTATCTCCTTTTTCCAAGG + Intergenic
985371502 4:189289960-189289982 TTTGTTGGTGCCTTTTTCCTGGG - Intergenic
987971586 5:24953429-24953451 TTTGTTTTGCCCTTTTCCCATGG + Intergenic
988051115 5:26032062-26032084 TTTGTCAGTTTCTTTTTTCAAGG - Intergenic
988286648 5:29227062-29227084 TTTGGTAGTTCATTTTTCCCTGG + Intergenic
988567973 5:32335467-32335489 TTTGTTAGGTTCTTTTCCCACGG - Intergenic
990082004 5:51928505-51928527 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
990421912 5:55644379-55644401 ATTCTTTGGTCCCTTTTCCATGG + Intronic
991135240 5:63175454-63175476 ATTGTTAGGTCCATTTCCAAGGG - Intergenic
993248792 5:85487669-85487691 TTTGTTGGGTTCTTTTTCCATGG + Intergenic
994653878 5:102564512-102564534 TTTTTTAGTTTCTATTTCCATGG - Intergenic
998650655 5:144117898-144117920 ATTATTAGCTCCATTTTCCAGGG - Intergenic
998684313 5:144506263-144506285 TGTGTTAGGTGCTTTTTAGATGG - Intergenic
1000096624 5:157976875-157976897 TTTGATATGTCCTCTATCCAAGG - Intergenic
1000312004 5:160054092-160054114 TTTGTTTGGTCCTTTTCTCTGGG + Intronic
1000907540 5:166980693-166980715 TATATTAGTTCATTTTTCCATGG - Intergenic
1002399574 5:178984075-178984097 TTTGGAAGGTCCTTTGTTCAGGG - Intronic
1004564456 6:16782292-16782314 TCTTTTTGGCCCTTTTTCCAAGG + Intergenic
1004765934 6:18726799-18726821 TTTGTTAGGTCCTTTTTCTATGG + Intergenic
1005349061 6:24916551-24916573 CTTGTTATGTTCTTTTTCCAGGG - Intronic
1005639410 6:27781832-27781854 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1006819793 6:36883742-36883764 TTTGTTAGGTCCTTTTTCCATGG + Intronic
1008290978 6:49715795-49715817 TTTGTTAGTTCCTTTTTCTATGG + Intergenic
1008854181 6:56061591-56061613 TTTCTTCGGTCCTTTTTGCTTGG - Intronic
1009371304 6:62906319-62906341 TTTGTTAGGTCATGTTTTCCTGG - Intergenic
1010403594 6:75476940-75476962 AATGTTAGGTCCTTCCTCCAAGG + Intronic
1011434583 6:87322880-87322902 TTTGTTCGGTGCTTCATCCATGG + Exonic
1012208361 6:96489611-96489633 TGTGTTAGGTCTTTCATCCAGGG - Intergenic
1014162942 6:118191063-118191085 TGTTTTAGGTCCTTTTTCCATGG - Intronic
1014491778 6:122071414-122071436 TTTGTTTGGTGTTTTTCCCATGG + Intergenic
1015391827 6:132690999-132691021 ATTGTTTGGTCCTTTATCCGTGG - Intronic
1016153120 6:140768881-140768903 TTTGTCATGTTATTTTTCCAAGG - Intergenic
1016230935 6:141803375-141803397 TTGGTTAGGTCCTGTTTTCCTGG + Intergenic
1016440156 6:144075139-144075161 TCAGTTAGGTCCCTTTTCCAAGG + Intergenic
1016727231 6:147386719-147386741 ATTGTTAGGTCCTATTTTAAAGG + Intergenic
1016759568 6:147722335-147722357 ATTGTTTGGTGCTTTTTTCATGG - Intronic
1017378494 6:153798832-153798854 TTTGTTAGGTTCTTTATCCATGG - Intergenic
1019270798 7:147252-147274 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1020647228 7:10829544-10829566 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1021132945 7:16933348-16933370 ATTTTTAGTTCCTATTTCCAAGG - Intergenic
1021590595 7:22256744-22256766 TGTGTTACTTCCCTTTTCCAGGG - Intronic
1021891458 7:25189752-25189774 TTTGTCAGGCCCTTTTTCCATGG - Intergenic
1022247822 7:28577476-28577498 TTTGTCAGGTGCTGTTTACAAGG + Intronic
1024124974 7:46284440-46284462 TTTGTTAGGAGCTGTTTGCAAGG + Intergenic
1025979869 7:66396568-66396590 TGAGTTAGGTCTTTTCTCCAGGG - Intronic
1027707636 7:81554317-81554339 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1029810795 7:103046396-103046418 TTTGTTAGGTCCTTTTTCCATGG - Intronic
1031305389 7:120119689-120119711 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1031467451 7:122130038-122130060 TTTGTGAGCTCCTTTATACAAGG - Intronic
1032475307 7:132207729-132207751 TTTGTTAGATCCCTTGTCCAAGG + Intronic
1032559947 7:132879128-132879150 TTTATTAGGTTAGTTTTCCATGG - Intronic
1032953768 7:136947137-136947159 TTTGGAAGGTCCTATGTCCAAGG + Intronic
1033072367 7:138215840-138215862 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1033850005 7:145483413-145483435 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1033962886 7:146935526-146935548 TTTGTTAGGTACTTTTTCCATGG + Intronic
1035142175 7:156773746-156773768 TTTCCTAGGTTTTTTTTCCAGGG - Intronic
1036119908 8:6004555-6004577 TTTCTTAGGTCCTTTTTTCCAGG - Intergenic
1036505363 8:9349961-9349983 TTTGTGAGTTCCTTGTTCCATGG + Intergenic
1037256868 8:16965227-16965249 TTTGTTAAGTGCCTCTTCCATGG - Intergenic
1038095987 8:24310722-24310744 TTTCTGAGCTCCATTTTCCATGG + Intronic
1041573273 8:59363047-59363069 TTGGTTACGTCCTATTTCCTGGG - Intergenic
1041604855 8:59769474-59769496 TTTTTCAAGTCCTTTTTCCATGG - Intergenic
1041813756 8:61942535-61942557 TTTTATAAGTCCTTTTTCTAAGG - Intergenic
1041903874 8:63010448-63010470 TTTGTTAGCTCCTTTGTCCTTGG + Intergenic
1043827093 8:84942307-84942329 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1046202582 8:110946833-110946855 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1047037655 8:120956864-120956886 GTTGTTAGGTCCTTTTTCCCTGG - Intergenic
1048162673 8:132035407-132035429 AAAGTTAGGTCCCTTTTCCAAGG + Intronic
1048489696 8:134881116-134881138 TCTCTGGGGTCCTTTTTCCAAGG - Intergenic
1050401237 9:5257968-5257990 TTTGTTAGGTCTTTTTTCTGTGG - Intergenic
1050658087 9:7851549-7851571 TTTGTTAGGTCCTTTTTCCATGG + Intronic
1051897923 9:22008145-22008167 ACTGTTAGGTCCTTTTTGAATGG - Intronic
1052090305 9:24319689-24319711 TGTGTTAGGTCATTCTTGCATGG + Intergenic
1052545008 9:29865081-29865103 TTTCTCAGCTCCTTTTTGCATGG - Intergenic
1052734100 9:32322712-32322734 TTTGTTCATTCTTTTTTCCAAGG + Intergenic
1053107027 9:35418356-35418378 TTGGTAATGTCCTTTTTGCAAGG - Intergenic
1054909048 9:70437297-70437319 TTTGACAAGTGCTTTTTCCATGG + Intergenic
1055661842 9:78511815-78511837 TTTGATAGGTACTTCTTCCAGGG + Intergenic
1056430309 9:86520921-86520943 TTTGTTAGGTCTTTTTTCCACGG + Intergenic
1057730375 9:97603128-97603150 TTTGATTGTTCCCTTTTCCAGGG + Intronic
1057781149 9:98051577-98051599 TTTGTTAAGTCCTTTTTCTATGG - Intergenic
1058098610 9:100892183-100892205 ACTGTTAGGTTCTTTTGCCATGG + Intergenic
1060119884 9:120979011-120979033 TTGCTTAGGTACTTTGTCCACGG + Intronic
1202802196 9_KI270720v1_random:10116-10138 TTTGATAGGTCCTTTTTCCATGG + Intergenic
1203435747 Un_GL000195v1:135498-135520 TGTGTGAGGTGATTTTTCCAAGG - Intergenic
1203446755 Un_GL000219v1:63887-63909 TTTGATAGGTCCTTTTTCCATGG + Intergenic
1185663857 X:1748762-1748784 TTTGTTAAGTCCTTGCACCAAGG - Intergenic
1186893397 X:13982397-13982419 TTTGTTAGGTCCTTTTTCCATGG + Intergenic
1188803079 X:34555564-34555586 TTTGTGTGGTCCTTTTTCCATGG + Intergenic
1189212893 X:39299763-39299785 TTTGTAAGATTCTTTCTCCAGGG + Intergenic
1190605030 X:52132435-52132457 TTTCCTAGGTTTTTTTTCCAGGG - Intergenic
1190827191 X:54028469-54028491 TTTCTTAGGTCCTCTTACCTGGG + Intronic
1191789650 X:64955983-64956005 TTTGTTAGATCTTTCTTCCTTGG + Intronic
1192983593 X:76372675-76372697 TTTGGTAAGTCCTTTTTCCTTGG - Intergenic
1193507938 X:82365587-82365609 ATTTGTAGGTCCTTTTTCCATGG - Intergenic
1194051511 X:89074933-89074955 TTTGTTAGGTCATTTTTCCATGG - Intergenic
1194235464 X:91378216-91378238 TTTCCTAGGTTATTTTTCCAGGG - Intergenic
1194507346 X:94749183-94749205 TTTGTGAGGTTTTTTTTCTAGGG + Intergenic
1194585237 X:95724864-95724886 TTTGCTAGTTCCGTTTTCCTTGG + Intergenic
1195558718 X:106258108-106258130 TTCATTAGGTCCTTTTTCCATGG - Intergenic
1196289831 X:113927029-113927051 TTTGTTAGTTCCCATTTTCATGG + Intergenic
1196400789 X:115313901-115313923 TTCGTTAGGTACTTTTTCCATGG - Intergenic
1196461236 X:115934429-115934451 TTGGTGAGGTCATGTTTCCATGG + Intergenic
1196542574 X:116926426-116926448 TTTGTTAGGTCCTTTTTCCATGG - Intergenic
1196889015 X:120274625-120274647 TTTGATAAGACCCTTTTCCATGG - Intronic
1196967934 X:121078533-121078555 TTTGTTAGGTCCTTTCTCCATGG - Intergenic
1196973465 X:121134202-121134224 TTTATTAGGTCCTTTTTCCATGG - Intergenic
1197011724 X:121571719-121571741 TTGGTTAGGTCATGTTTCCTCGG - Intergenic
1197176535 X:123492200-123492222 TTTGTTTCCTCCTTCTTCCAAGG - Intergenic
1197243086 X:124140550-124140572 TTTGTTAGCAACTTTCTCCATGG - Intronic
1197554135 X:127933773-127933795 TTTGTTTGGTCCTTTTTTCATGG + Intergenic
1198785520 X:140283659-140283681 GGTGTGAGGTCCCTTTTCCAGGG - Intergenic
1198949566 X:142055481-142055503 TTTGCTAGGTCCTTTTTCCTTGG - Intergenic
1199904706 X:152213151-152213173 TTTGTTACTTCCTTTTTTCCTGG - Intronic
1200407573 Y:2829100-2829122 TTTGTTAGGTTTTTCTTCCATGG - Intergenic
1200761915 Y:7046600-7046622 TTTGTTAGGTCCTTTTTCAGGGG - Intronic
1202341661 Y:23875325-23875347 ATTGTAAACTCCTTTTTCCATGG + Intergenic
1202529105 Y:25794761-25794783 ATTGTAAACTCCTTTTTCCATGG - Intergenic