ID: 1088111890

View in Genome Browser
Species Human (GRCh38)
Location 11:106271390-106271412
Sequence AGCTTGATGAAATGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088111884_1088111890 23 Left 1088111884 11:106271344-106271366 CCTGAGTCACATTGCTGAAGTCC No data
Right 1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG No data
1088111887_1088111890 2 Left 1088111887 11:106271365-106271387 CCATTGAGAATAGGAGGATAAAG No data
Right 1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088111890 Original CRISPR AGCTTGATGAAATGTGGGTT TGG Intergenic
No off target data available for this crispr