ID: 1088119406

View in Genome Browser
Species Human (GRCh38)
Location 11:106350584-106350606
Sequence AGTCACAAGCCTGAGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088119406_1088119407 -4 Left 1088119406 11:106350584-106350606 CCTCAAAACTCAGGCTTGTGACT No data
Right 1088119407 11:106350603-106350625 GACTTAAATTTACCTTGTTCAGG No data
1088119406_1088119408 6 Left 1088119406 11:106350584-106350606 CCTCAAAACTCAGGCTTGTGACT No data
Right 1088119408 11:106350613-106350635 TACCTTGTTCAGGTTTCCAAAGG No data
1088119406_1088119411 29 Left 1088119406 11:106350584-106350606 CCTCAAAACTCAGGCTTGTGACT No data
Right 1088119411 11:106350636-106350658 AATGACTCATAGCCAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088119406 Original CRISPR AGTCACAAGCCTGAGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr