ID: 1088125184

View in Genome Browser
Species Human (GRCh38)
Location 11:106415774-106415796
Sequence TGTGAGCAGGAGCACTGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088125179_1088125184 5 Left 1088125179 11:106415746-106415768 CCGTACTGCATAGGTCTCAGGTG No data
Right 1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088125184 Original CRISPR TGTGAGCAGGAGCACTGTGG GGG Intergenic
No off target data available for this crispr