ID: 1088129092

View in Genome Browser
Species Human (GRCh38)
Location 11:106465523-106465545
Sequence AATGATGACCTTGATGGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088129083_1088129092 3 Left 1088129083 11:106465497-106465519 CCTGGGCCCTGGAAACTTGTCTG No data
Right 1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG No data
1088129078_1088129092 25 Left 1088129078 11:106465475-106465497 CCTCTGACTCCAAGGTCTGGTTC No data
Right 1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG No data
1088129081_1088129092 16 Left 1088129081 11:106465484-106465506 CCAAGGTCTGGTTCCTGGGCCCT No data
Right 1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG No data
1088129088_1088129092 -4 Left 1088129088 11:106465504-106465526 CCTGGAAACTTGTCTGGGGAATG No data
Right 1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG No data
1088129087_1088129092 -3 Left 1088129087 11:106465503-106465525 CCCTGGAAACTTGTCTGGGGAAT No data
Right 1088129092 11:106465523-106465545 AATGATGACCTTGATGGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088129092 Original CRISPR AATGATGACCTTGATGGGGT AGG Intergenic
No off target data available for this crispr