ID: 1088130566

View in Genome Browser
Species Human (GRCh38)
Location 11:106484176-106484198
Sequence AGTTCAGGAGCTGTGAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130566_1088130571 -10 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130571 11:106484189-106484211 CTCCTGAACTTTATGGGTTTGGG No data
1088130566_1088130573 -4 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130573 11:106484195-106484217 AACTTTATGGGTTTGGGTGCAGG No data
1088130566_1088130576 17 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130576 11:106484216-106484238 GGGAGATAGGATTTAGCAAGTGG No data
1088130566_1088130575 4 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130575 11:106484203-106484225 GGGTTTGGGTGCAGGGAGATAGG No data
1088130566_1088130574 -3 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130574 11:106484196-106484218 ACTTTATGGGTTTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130566 Original CRISPR AGTTCAGGAGCTGTGAGGTA TGG (reversed) Intergenic