ID: 1088130567

View in Genome Browser
Species Human (GRCh38)
Location 11:106484181-106484203
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130567_1088130578 27 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130578 11:106484231-106484253 GCAAGTGGAATGACGCATCTGGG No data
1088130567_1088130577 26 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130577 11:106484230-106484252 AGCAAGTGGAATGACGCATCTGG No data
1088130567_1088130576 12 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130576 11:106484216-106484238 GGGAGATAGGATTTAGCAAGTGG No data
1088130567_1088130574 -8 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130574 11:106484196-106484218 ACTTTATGGGTTTGGGTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 155
1088130567_1088130573 -9 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130573 11:106484195-106484217 AACTTTATGGGTTTGGGTGCAGG 0: 1
1: 0
2: 2
3: 20
4: 181
1088130567_1088130575 -1 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130575 11:106484203-106484225 GGGTTTGGGTGCAGGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130567 Original CRISPR CATAAAGTTCAGGAGCTGTG AGG (reversed) Intergenic