ID: 1088130571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:106484189-106484211 |
| Sequence | CTCCTGAACTTTATGGGTTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1088130566_1088130571 | -10 | Left | 1088130566 | 11:106484176-106484198 | CCATACCTCACAGCTCCTGAACT | No data | ||
| Right | 1088130571 | 11:106484189-106484211 | CTCCTGAACTTTATGGGTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1088130571 | Original CRISPR | CTCCTGAACTTTATGGGTTT GGG | Intergenic | ||