ID: 1088130571

View in Genome Browser
Species Human (GRCh38)
Location 11:106484189-106484211
Sequence CTCCTGAACTTTATGGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130566_1088130571 -10 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130571 11:106484189-106484211 CTCCTGAACTTTATGGGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130571 Original CRISPR CTCCTGAACTTTATGGGTTT GGG Intergenic