ID: 1088130572

View in Genome Browser
Species Human (GRCh38)
Location 11:106484191-106484213
Sequence CACCCAAACCCATAAAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130572_1088130579 26 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130579 11:106484240-106484262 ATGACGCATCTGGGTTTTGACGG No data
1088130572_1088130576 2 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130576 11:106484216-106484238 GGGAGATAGGATTTAGCAAGTGG No data
1088130572_1088130577 16 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130577 11:106484230-106484252 AGCAAGTGGAATGACGCATCTGG No data
1088130572_1088130580 27 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130580 11:106484241-106484263 TGACGCATCTGGGTTTTGACGGG No data
1088130572_1088130578 17 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130578 11:106484231-106484253 GCAAGTGGAATGACGCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130572 Original CRISPR CACCCAAACCCATAAAGTTC AGG (reversed) Intergenic