ID: 1088130573

View in Genome Browser
Species Human (GRCh38)
Location 11:106484195-106484217
Sequence AACTTTATGGGTTTGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130566_1088130573 -4 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130573 11:106484195-106484217 AACTTTATGGGTTTGGGTGCAGG No data
1088130567_1088130573 -9 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130573 11:106484195-106484217 AACTTTATGGGTTTGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130573 Original CRISPR AACTTTATGGGTTTGGGTGC AGG Intergenic