ID: 1088130574

View in Genome Browser
Species Human (GRCh38)
Location 11:106484196-106484218
Sequence ACTTTATGGGTTTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130566_1088130574 -3 Left 1088130566 11:106484176-106484198 CCATACCTCACAGCTCCTGAACT No data
Right 1088130574 11:106484196-106484218 ACTTTATGGGTTTGGGTGCAGGG No data
1088130567_1088130574 -8 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130574 11:106484196-106484218 ACTTTATGGGTTTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130574 Original CRISPR ACTTTATGGGTTTGGGTGCA GGG Intergenic