ID: 1088130577

View in Genome Browser
Species Human (GRCh38)
Location 11:106484230-106484252
Sequence AGCAAGTGGAATGACGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130572_1088130577 16 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130577 11:106484230-106484252 AGCAAGTGGAATGACGCATCTGG No data
1088130567_1088130577 26 Left 1088130567 11:106484181-106484203 CCTCACAGCTCCTGAACTTTATG No data
Right 1088130577 11:106484230-106484252 AGCAAGTGGAATGACGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130577 Original CRISPR AGCAAGTGGAATGACGCATC TGG Intergenic