ID: 1088130580

View in Genome Browser
Species Human (GRCh38)
Location 11:106484241-106484263
Sequence TGACGCATCTGGGTTTTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088130572_1088130580 27 Left 1088130572 11:106484191-106484213 CCTGAACTTTATGGGTTTGGGTG No data
Right 1088130580 11:106484241-106484263 TGACGCATCTGGGTTTTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088130580 Original CRISPR TGACGCATCTGGGTTTTGAC GGG Intergenic
No off target data available for this crispr