ID: 1088138790

View in Genome Browser
Species Human (GRCh38)
Location 11:106590980-106591002
Sequence CAGGGAAGCCATTTTAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088138790_1088138793 -5 Left 1088138790 11:106590980-106591002 CCAAACCTAAAATGGCTTCCCTG No data
Right 1088138793 11:106590998-106591020 CCCTGCTGATTATCCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088138790 Original CRISPR CAGGGAAGCCATTTTAGGTT TGG (reversed) Intergenic