ID: 1088141552

View in Genome Browser
Species Human (GRCh38)
Location 11:106622870-106622892
Sequence CTTATATTCTCGTAAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088141552_1088141558 -7 Left 1088141552 11:106622870-106622892 CCTCCACCTTACGAGAATATAAG No data
Right 1088141558 11:106622886-106622908 ATATAAGATCTGGAAGAGGTGGG No data
1088141552_1088141557 -8 Left 1088141552 11:106622870-106622892 CCTCCACCTTACGAGAATATAAG No data
Right 1088141557 11:106622885-106622907 AATATAAGATCTGGAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088141552 Original CRISPR CTTATATTCTCGTAAGGTGG AGG (reversed) Intergenic
No off target data available for this crispr