ID: 1088144140

View in Genome Browser
Species Human (GRCh38)
Location 11:106653639-106653661
Sequence GTGCTACTCACTAGTAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088144140_1088144141 -3 Left 1088144140 11:106653639-106653661 CCATGATTACTAGTGAGTAGCAC No data
Right 1088144141 11:106653659-106653681 CACACCCTTCACATATGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088144140 Original CRISPR GTGCTACTCACTAGTAATCA TGG (reversed) Intergenic
No off target data available for this crispr