ID: 1088148970

View in Genome Browser
Species Human (GRCh38)
Location 11:106721030-106721052
Sequence ATGCTTCTCCACCAATAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088148970 Original CRISPR ATGCTTCTCCACCAATAAAA AGG Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901737166 1:11319885-11319907 CAGTTTCTTCACCAATAAAATGG - Intergenic
902807003 1:18867389-18867411 AAGCTTCCCCACCTGTAAAACGG + Intronic
904189116 1:28729800-28729822 ATGTCCCCCCACCAATAAAAGGG + Intergenic
904946760 1:34204938-34204960 ATGCATCTCCACCTCTAAAGGGG + Intronic
905464512 1:38142559-38142581 CTGCTTCTTCATCAGTAAAATGG + Intergenic
905924249 1:41738741-41738763 TAGCTTCTTCACCAGTAAAATGG + Intronic
905970944 1:42141986-42142008 ATGCCTCTCCATCTATAAAATGG - Intergenic
906229014 1:44144664-44144686 CTACTTCTACACCAATAGAAAGG + Intergenic
906881250 1:49593691-49593713 ATGTTTCTTCATCCATAAAATGG + Intronic
908069407 1:60441766-60441788 ATGCTTCTCGTCCAAATAAATGG + Intergenic
911085980 1:93977866-93977888 ATGCTTCTCGACCCATAGTAGGG + Intergenic
913401072 1:118433620-118433642 ATGCTAATCAACAAATAAAATGG - Intergenic
913500643 1:119469663-119469685 CAGTTTCTTCACCAATAAAATGG + Intergenic
915614987 1:157030759-157030781 ATGCTTCCCTATCTATAAAATGG + Intronic
916830146 1:168482462-168482484 ATGTTGCTCCTCCCATAAAAAGG - Intergenic
916899509 1:169205557-169205579 CTGTTTCTTCACCAATAAAACGG - Intronic
920585371 1:207153708-207153730 ATTCTTATCCACTCATAAAATGG - Intergenic
920927081 1:210351909-210351931 ATGCTGCTCCACCTGTAAAAAGG - Intronic
921583086 1:216917426-216917448 ATGTTTCTCATCCATTAAAAGGG + Intronic
922473860 1:225892597-225892619 ATACGTTTCCACCTATAAAATGG + Intronic
923749383 1:236733516-236733538 ATTCTTCTGAACCATTAAAAGGG - Intronic
923822742 1:237463876-237463898 ATGCCTTTCCAAAAATAAAACGG - Intronic
1063422339 10:5923297-5923319 CTGCTTTCCCATCAATAAAAAGG - Intronic
1064627549 10:17276738-17276760 AGGCTTCTCATCAAATAAAATGG - Intergenic
1065632061 10:27690559-27690581 AGGTTTCTTCACCTATAAAATGG + Intronic
1066489019 10:35876053-35876075 CAGCTTCTTCATCAATAAAATGG - Intergenic
1067526539 10:47042750-47042772 ATGTTTCTCTACCTGTAAAATGG + Intergenic
1067934272 10:50595528-50595550 GTGATTCTTCACCTATAAAATGG - Intronic
1070403266 10:76072281-76072303 ATCCCTCTCCACCACTTAAAGGG + Intronic
1071150609 10:82630036-82630058 CTTCTTCCCCAGCAATAAAAGGG + Intronic
1071500044 10:86196906-86196928 ATGCTTCTGGGCCAATAAATGGG + Intronic
1073172003 10:101518530-101518552 ATGCTACTCCTCCCATCAAAAGG - Intronic
1074127802 10:110543667-110543689 CAGTTTCTCCACAAATAAAATGG + Intergenic
1074291577 10:112141483-112141505 GTGCTTCTCCATCTGTAAAATGG + Intergenic
1075635520 10:124027729-124027751 AGCCTTCTCCCCCAGTAAAATGG - Intronic
1076224036 10:128759002-128759024 ATGCTTCTCCAACAATGGAGGGG - Intergenic
1080436601 11:32250377-32250399 CTGCTTCTCCATCTATAAAGTGG + Intergenic
1080525472 11:33112361-33112383 CAGCTTTTCCACCTATAAAATGG + Intronic
1081131029 11:39380614-39380636 ATGCTTATCCATTTATAAAATGG - Intergenic
1082643718 11:55695467-55695489 AAGTTTCTCTACCAATACAAAGG - Intergenic
1083279748 11:61619509-61619531 AGGCTTCACCATCATTAAAAAGG - Intergenic
1083467255 11:62856648-62856670 AGGGTTCCCCATCAATAAAATGG - Intronic
1083846240 11:65335342-65335364 AGGTTTCTCCAAAAATAAAAAGG + Intronic
1084901232 11:72311454-72311476 ATGTTTCCTCACCTATAAAATGG - Intronic
1085366416 11:75950090-75950112 ATACTGCTTCACCAGTAAAAAGG - Intronic
1085913231 11:80853290-80853312 ATACTACTCCAGAAATAAAAAGG + Intergenic
1086325704 11:85696663-85696685 TTGCTTCTTCATCTATAAAATGG + Intronic
1086887210 11:92219934-92219956 ATGTTTCTTTACCAATCAAAGGG - Intergenic
1088148970 11:106721030-106721052 ATGCTTCTCCACCAATAAAAAGG + Intronic
1088707494 11:112477115-112477137 GTGATTCTGCACCTATAAAATGG + Intergenic
1090069162 11:123528513-123528535 CTGCTTCCCCATCCATAAAATGG - Intronic
1091390825 12:125262-125284 CTGTTTCTCCATCTATAAAATGG - Intronic
1094868297 12:34566930-34566952 AAACTGCTCAACCAATAAAATGG + Intergenic
1095378778 12:41563943-41563965 ATGCTTTTCCCCCCTTAAAAGGG - Intronic
1097064221 12:56308924-56308946 CAGCTTCTTCATCAATAAAATGG + Intronic
1097579374 12:61434808-61434830 ATGCTTGGCCACCAAGATAAAGG + Intergenic
1098101022 12:67017567-67017589 ATGCTGTTCTACCAATCAAAAGG + Intergenic
1098277173 12:68824743-68824765 ATTCATCTCAACCAAAAAAAGGG - Intronic
1098888134 12:75981193-75981215 ATCCATCTCCATCTATAAAATGG + Intergenic
1100378497 12:94039985-94040007 TGGCTTCTCCATCTATAAAATGG + Intergenic
1100425430 12:94480749-94480771 ATGCTTCTTCAACAAATAAATGG + Intergenic
1101317312 12:103641367-103641389 ATGTTTCTTCAACCATAAAAGGG + Intronic
1102000217 12:109553018-109553040 TTGCTCCTCCACCTATAGAATGG - Intergenic
1102427335 12:112854279-112854301 TTCCTTCTCCACCAACAAAAGGG - Intronic
1103339593 12:120214467-120214489 ATGTTTCTTCACTTATAAAATGG - Intronic
1105837870 13:24226135-24226157 ATGCCTTTCAACCAATCAAATGG - Intronic
1107155062 13:37156317-37156339 ATACTTATCCACCCACAAAATGG + Intergenic
1107406015 13:40114210-40114232 ATGCTGCTCTACGACTAAAATGG + Intergenic
1108590655 13:51910434-51910456 AAACTTCTCCACAAAAAAAAGGG + Intergenic
1108781594 13:53843215-53843237 ATTTTTCTCCACCAGTAACATGG - Intergenic
1110063158 13:71067147-71067169 ATGCTTATCAACCAACAAATAGG - Intergenic
1110505783 13:76284496-76284518 TTACTTCTCCATCTATAAAATGG + Intergenic
1110936011 13:81290339-81290361 ATACTTGTCCAACAGTAAAATGG - Intergenic
1117553453 14:56859376-56859398 CGGCTTCTCCACCTTTAAAATGG - Intergenic
1118891316 14:69911688-69911710 ATACTACTCAGCCAATAAAAAGG - Intronic
1120019420 14:79511423-79511445 ATGCTTCTGCACCTAGAACATGG - Intronic
1120093721 14:80364199-80364221 ATACCTCTCCATGAATAAAAAGG + Intronic
1121717261 14:96085117-96085139 CTGCTTATCCACCTGTAAAATGG + Intronic
1122795788 14:104205540-104205562 ATGCTGCCCCACCCATGAAAGGG - Intergenic
1123733385 15:23164137-23164159 TTGTTTCCCCACCTATAAAATGG + Intergenic
1123751514 15:23361508-23361530 TTGTTTCCCCACCTATAAAATGG + Intronic
1124283887 15:28385433-28385455 TTGTTTCCCCACCTATAAAATGG + Intronic
1124298811 15:28526181-28526203 TTGTTTCCCCACCTATAAAATGG - Intronic
1126228080 15:46294632-46294654 CTGCTTCTCCATCTGTAAAATGG + Intergenic
1127350032 15:58142036-58142058 CAGCTTCTCCACCAATAAAAAGG - Intronic
1128335724 15:66784607-66784629 CTGTTTCCTCACCAATAAAATGG - Intergenic
1130571196 15:85045488-85045510 CAGCTTCTTCATCAATAAAATGG + Intronic
1130887863 15:88109080-88109102 ATGCTTCTCCCCCAATCCATGGG + Intronic
1131246745 15:90800769-90800791 TTACTTCTCAACCAAAAAAAAGG + Intronic
1131754527 15:95545414-95545436 AGGCTTCTCCACAGATCAAAAGG + Intergenic
1132177257 15:99725599-99725621 TTGATTCTCCACCAAGAAAATGG + Intronic
1132262121 15:100434824-100434846 CTGTTTCTCTACTAATAAAAAGG + Intronic
1133205651 16:4231959-4231981 TTGTTTCTTCACCCATAAAATGG - Intronic
1133689625 16:8200767-8200789 AAGGTTCTCCCCCAAGAAAAGGG + Intergenic
1134200399 16:12193194-12193216 ATGCTTACTCATCAATAAAAAGG - Intronic
1134228092 16:12407678-12407700 TTGATTCTTCACCTATAAAATGG - Intronic
1135384560 16:22025755-22025777 ATGCTTCTTCAACAGCAAAATGG - Intronic
1137431778 16:48423999-48424021 ATTATTATTCACCAATAAAAAGG - Intronic
1138611442 16:58128695-58128717 CTGTTTCCCCACCAATATAATGG - Intronic
1138878199 16:60978985-60979007 GTGCATCACCACCAATGAAATGG + Intergenic
1139160085 16:64494353-64494375 CTGTTTCTCCACCAAGAAACAGG + Intergenic
1140202191 16:72903674-72903696 ATCTTTCTCAACTAATAAAATGG - Intronic
1141647592 16:85375906-85375928 CTGTTTCTTCACCTATAAAATGG - Intergenic
1144294416 17:13859779-13859801 ATTCTTATACACCAATAACAAGG + Intergenic
1144810456 17:17995500-17995522 ATGTTTCCCCAACTATAAAATGG - Intronic
1145114509 17:20196632-20196654 ATTCTTCTCCTAAAATAAAATGG - Intronic
1146474837 17:33154435-33154457 ATGCTTCCCCAACAATATCATGG + Intronic
1146569957 17:33943844-33943866 CAGCTTCTTCACCAATAAAACGG - Intronic
1147653244 17:42073726-42073748 TTGCTTCTCCAACAACAGAATGG - Intergenic
1147907371 17:43832207-43832229 CTGTTTCTTCATCAATAAAATGG - Intronic
1150238731 17:63614779-63614801 ATGCTTCTTTACCTGTAAAATGG + Intergenic
1151640196 17:75386852-75386874 CTGTTTCTGCACCCATAAAATGG + Intronic
1153543014 18:6177274-6177296 ATGCTAGTTCAGCAATAAAAAGG + Intronic
1154606751 18:16454262-16454284 AAGCTTCTCTACGAATAGAAAGG - Intergenic
1154653046 18:17090244-17090266 AAGCTTCTCTACGAATAGAAAGG - Intergenic
1155107103 18:22678209-22678231 ATGTTTCTCCAGCAAGGAAAGGG - Intergenic
1157511580 18:48279206-48279228 CTCCTGCTCCACCATTAAAACGG + Intronic
1162711206 19:12596344-12596366 TTGCTTCTCCACCGTTAAAATGG + Intronic
1167916902 19:52748372-52748394 ATCTTTCTCCACCAGAAAAATGG + Intergenic
925196719 2:1931729-1931751 CTACTTATCCACCAATAGAAGGG + Intronic
926357231 2:12052277-12052299 ATGTTTCTTCATCTATAAAATGG + Intergenic
926553994 2:14335220-14335242 ATGCTTCACTACAAATAAGAGGG - Intergenic
929085057 2:38159793-38159815 TTGCTTCACTGCCAATAAAAGGG - Intergenic
930537509 2:52662381-52662403 ATGCTTTTCCCCCAGGAAAATGG + Intergenic
930669488 2:54133312-54133334 ATGCAGCTGCAGCAATAAAAAGG - Intronic
930995639 2:57714295-57714317 GTGCTTCTCCACCATTAACAAGG - Intergenic
931060453 2:58523088-58523110 ATGCTGCTCCTCTAATAAAGTGG - Intergenic
931077505 2:58733030-58733052 CTGCTTGTCCATCTATAAAATGG + Intergenic
931093166 2:58909313-58909335 ATCATTCCCCACCAACAAAATGG + Intergenic
932052925 2:68416987-68417009 ATGCTTTTTAACCAATCAAATGG - Intergenic
932798415 2:74717769-74717791 CTGCTTCCCCATCCATAAAATGG - Intergenic
935254773 2:101300015-101300037 ATGCTTCTGCAGCTACAAAATGG + Intronic
935676832 2:105601568-105601590 AAGCTCCTCCACCAACAAAATGG - Intergenic
936373479 2:111921934-111921956 TTCCTTCCCCAACAATAAAATGG - Intronic
938644466 2:133316914-133316936 TTGCTTCTCCTCCAACAAAAAGG + Intronic
940656738 2:156496157-156496179 TTGCTCCTCCTCCAATAACAAGG - Exonic
940721105 2:157283182-157283204 TTGATTATTCACCAATAAAAAGG + Intronic
941901305 2:170681522-170681544 ATTTTTCCCCACCAATAAAATGG + Intergenic
943071453 2:183145679-183145701 GTGTTACTCCAACAATAAAATGG + Intronic
943133351 2:183884454-183884476 ATTCTTATTCAGCAATAAAAAGG - Intergenic
943441946 2:187935762-187935784 TTGCCTTTCCACCAATTAAATGG - Intergenic
943644571 2:190395961-190395983 ATACTGCTCAAGCAATAAAAAGG + Intergenic
944852778 2:203736768-203736790 ATGGTTCTTCAACTATAAAATGG + Exonic
946771687 2:223095440-223095462 ATTTTTAACCACCAATAAAAAGG - Intronic
948064702 2:235068658-235068680 ATCCTGTTCCACCATTAAAAGGG + Intergenic
1169382123 20:5117009-5117031 CTGCTTCTCCACCTTTAAAATGG + Intronic
1169776029 20:9254071-9254093 AAGCTTCTCTACCAAGAAACAGG - Intronic
1170985614 20:21255454-21255476 ATTCTTATACACCAATAACAGGG + Intergenic
1170996656 20:21367020-21367042 AGGCTTCTACACCAATATATTGG - Intronic
1171334642 20:24372147-24372169 ATCCTTCTCCACAGAGAAAATGG + Intergenic
1174043839 20:47719213-47719235 ATGCTTCTTTACACATAAAATGG - Intronic
1175049012 20:56135736-56135758 CAGCTTCTCCATCAGTAAAATGG + Intergenic
1179160376 21:38891360-38891382 ATGTTGCTCCACCAATAATTTGG + Intergenic
1179396357 21:41043809-41043831 ATGCTGATCCACCAAGAGAAAGG - Intergenic
1180572345 22:16738355-16738377 CTACTTCTCCATCAGTAAAATGG + Intergenic
1180576733 22:16782916-16782938 ATGCTTCACCACCAATCATCAGG + Intergenic
949610637 3:5699846-5699868 ATGCTTCTCTACTAATAAGATGG - Intergenic
950559051 3:13711483-13711505 AGGCTTGTCTACCATTAAAAGGG + Intergenic
951410012 3:22352076-22352098 ATGATTCTCCAGCAATATGATGG + Intronic
952006266 3:28845720-28845742 TTGATTCTTCACCAATAAAATGG + Intergenic
952528778 3:34241889-34241911 ATGTTTCTTCATCTATAAAATGG + Intergenic
957092688 3:75747662-75747684 ATTCTTATACACCAATAACAGGG - Intronic
957105348 3:75880533-75880555 CTACTTCTCCATCAGTAAAATGG - Intergenic
957547461 3:81658555-81658577 AAGCTTCTGCACCTATAAAAAGG + Intronic
959608436 3:108267261-108267283 AAGCTTCTCGACCACTAAGAAGG - Intergenic
960572202 3:119196287-119196309 ATCCTTTTCCACCAAGAAAAAGG + Intronic
961074650 3:123970816-123970838 ATATTTCCCCAGCAATAAAAGGG - Intronic
961202036 3:125053033-125053055 AAGCTTCTCCAACAACCAAATGG + Intronic
961309032 3:125981670-125981692 ATATTTCCCCAGCAATAAAAGGG + Intronic
961461088 3:127050844-127050866 CTGCTTGGACACCAATAAAAAGG + Intergenic
961484534 3:127207764-127207786 ATGCCTCTCCAGAAAGAAAAAGG - Intergenic
962026203 3:131550382-131550404 CTGTTTCTTCACCTATAAAATGG - Intronic
963933760 3:151031740-151031762 ATGCCTCTCTACCATAAAAAAGG + Intergenic
964050816 3:152391087-152391109 CTGTTTCTTCACCAATAAAATGG - Intronic
964253506 3:154748105-154748127 ATAGTTCTCTACCAATTAAAGGG - Intergenic
964689832 3:159437967-159437989 CAGCTTCTCCAGCTATAAAATGG + Intronic
965053555 3:163683943-163683965 TTACTTCTCCCCCAATACAATGG + Intergenic
965430493 3:168581726-168581748 TTGATTCTCCACCAAAACAAGGG - Intergenic
966546301 3:181152882-181152904 ATGCTACTCAGCCAATAAAAAGG + Intergenic
967298484 3:187988627-187988649 ATGCTCCTTTTCCAATAAAAAGG + Intergenic
967328952 3:188271263-188271285 TTTCTTCTCCAACAATAAGAGGG - Intronic
967775549 3:193382401-193382423 ATTTTTCTCCACCCATTAAATGG + Intergenic
967834812 3:193952103-193952125 CTGCTTCTTCATCTATAAAATGG + Intergenic
967998473 3:195184841-195184863 ATTCATCTTTACCAATAAAATGG + Intronic
970557225 4:17246393-17246415 CAGCTTCTTCACCTATAAAATGG + Intergenic
970619965 4:17808138-17808160 ATGCTACTACAGCAATATAAAGG + Intronic
970781818 4:19746589-19746611 GGGCGTCTCCACCAATAAACAGG + Intergenic
972995649 4:44876134-44876156 ATGCTTCTCTACCAGTAACAAGG + Intergenic
977318938 4:95486734-95486756 ATGCTTCTCCACCAAGACCCTGG + Intronic
977741486 4:100489059-100489081 AGGTTTCTCCATCTATAAAATGG - Intronic
977889149 4:102287751-102287773 ATGCTTCTCATCGATTAAAATGG - Intronic
978533865 4:109740508-109740530 CTCCTTTTCCACCTATAAAATGG - Intergenic
979555737 4:122044947-122044969 ATGACTCTCCAGCAATGAAAGGG + Intergenic
979683018 4:123482177-123482199 AAGCTTTTCCACCTATAAATGGG + Intergenic
981103378 4:140854960-140854982 ATGATCCTCCTCCCATAAAAGGG - Intergenic
982547258 4:156749419-156749441 ATGGTTCTCTACCACTTAAATGG - Intergenic
983761094 4:171407273-171407295 ATGCCTTTTCACCAATCAAATGG - Intergenic
986755517 5:10832281-10832303 ATTCTTCTTCACCTGTAAAATGG + Intergenic
988139680 5:27219510-27219532 ATGTTTCCTCATCAATAAAATGG + Intergenic
989451467 5:41591145-41591167 ATGCTTCTCCTCCCACAAAAAGG - Intergenic
990004211 5:50925990-50926012 TTAATGCTCCACCAATAAAATGG + Intergenic
990076912 5:51857381-51857403 TTGCTTCTCTACCAATATGAGGG - Intergenic
990097716 5:52137847-52137869 TTTCTTTTCCACAAATAAAAAGG - Intergenic
990335460 5:54768045-54768067 TTGCTACTACACCAATAAATAGG + Intergenic
990625954 5:57611510-57611532 ATGCTTCTACTGAAATAAAATGG + Intergenic
990649116 5:57878223-57878245 ATGTTTCTCCCCCAAGGAAATGG - Intergenic
990719056 5:58672710-58672732 ATGATTATTCAGCAATAAAAAGG + Intronic
990806845 5:59672959-59672981 ATGTTTTTCCATCTATAAAAAGG + Intronic
992198092 5:74359454-74359476 TTGTTTCTCCATCTATAAAATGG - Intergenic
998932049 5:147191902-147191924 CTGTTTCTCCATCTATAAAATGG - Intergenic
1000906838 5:166974589-166974611 TTGTTTCTCCATCTATAAAATGG + Intergenic
1001818315 5:174690110-174690132 CAGCTTCCCCACCTATAAAATGG - Intergenic
1002954882 6:1852542-1852564 AAGCTTCCCCTCCACTAAAAAGG + Intronic
1005355832 6:24982646-24982668 ATGCTTCTCTACATATAAAATGG + Intronic
1005819295 6:29584152-29584174 ATGCTTCTCTTCCATTAGAAAGG - Intronic
1006373921 6:33661453-33661475 GAGTTTCTCCACCCATAAAATGG + Intronic
1007313712 6:40967258-40967280 ATGTTTCCCCACCTATATAATGG - Intergenic
1009246406 6:61243985-61244007 ATGTTTCTCCACCACTAAAGTGG + Intergenic
1010114235 6:72282674-72282696 CTGTTTCTTCACCTATAAAATGG + Intronic
1012683379 6:102210821-102210843 ATGCTTCACCATTAACAAAATGG - Intergenic
1012971207 6:105733381-105733403 ATCCTTTTCCACCATTGAAATGG - Intergenic
1013349884 6:109295988-109296010 CTGCTTGTCCATCTATAAAATGG + Intergenic
1014782535 6:125581324-125581346 ATACTTCTTCATCTATAAAACGG - Intergenic
1014947225 6:127513800-127513822 TAGCTTCTGCACCTATAAAATGG + Intronic
1015598514 6:134889687-134889709 ATGCTACTCAACCATTAAAGTGG - Intergenic
1015615785 6:135073234-135073256 TTACTTCTCCATCAAGAAAAAGG + Intronic
1016780988 6:147958142-147958164 ATGCTTCTGCACCAGAAAGAAGG + Intergenic
1018601623 6:165549950-165549972 ATCTTTCTCCACAATTAAAATGG - Intronic
1018938265 6:168289121-168289143 AAACTTCTCCACAAAAAAAAGGG + Intergenic
1019282593 7:207870-207892 TTCCTTCTCCACCAGCAAAAAGG + Intronic
1019702940 7:2482890-2482912 CAGTTTCTCCATCAATAAAATGG - Intergenic
1019785250 7:2972765-2972787 GTGCTACTCAGCCAATAAAAGGG - Intronic
1019857911 7:3627725-3627747 TTTCTTCTCAACTAATAAAATGG - Intronic
1019940835 7:4288664-4288686 ATGCTTTTCCCCCAAGATAAGGG - Intergenic
1020285494 7:6676556-6676578 AGGCCTCTCCACAAATGAAATGG + Intergenic
1020485782 7:8718677-8718699 TTGCTTCTCTACCATTAAAGAGG + Intronic
1020684538 7:11276840-11276862 ATGCTGATCCAGCAATGAAAAGG - Intergenic
1022324920 7:29322431-29322453 AAGCTTCTCCAGCTACAAAATGG + Intronic
1022884015 7:34622945-34622967 ATACCTCTCCAACAATAAAGTGG + Intergenic
1023514503 7:40987485-40987507 ATGATTCTCCACCAGAAGAAAGG - Intergenic
1023523513 7:41073204-41073226 TAGTTTCTCCACCAATAAATAGG + Intergenic
1023615502 7:42015624-42015646 GAGTTTCTCCACCAAGAAAACGG + Intronic
1023710868 7:42991352-42991374 ATGCTTCTCCCCCAAAAGCAAGG + Intergenic
1024819457 7:53310495-53310517 TTACTTTTCCACCAATATAATGG + Intergenic
1025217949 7:57075916-57075938 ACTCCTCACCACCAATAAAAAGG - Intergenic
1025518607 7:61688908-61688930 AAGCTTCTCAATCAATAGAAAGG + Intergenic
1025542932 7:62117555-62117577 AAGCTTCTCAATCAATAGAAAGG + Intergenic
1025653397 7:63494541-63494563 ACTCCTCACCACCAATAAAAAGG + Intergenic
1027533622 7:79367736-79367758 ATGCTTATTCATCAATAAATTGG - Intronic
1027750606 7:82140310-82140332 TTTCTTCTTCACCAATAAATGGG + Intronic
1027919745 7:84377880-84377902 ATGATTCACCACCAATAACATGG - Intronic
1028363800 7:90002755-90002777 ATGGCTCTCCACAAATAACAAGG - Intergenic
1029185778 7:98737401-98737423 CTGCTTCTTCAGCTATAAAATGG + Intergenic
1031291212 7:119938345-119938367 ATGTGTCTCCACTAATAGAAGGG + Intergenic
1032525193 7:132574660-132574682 ATGCTTTTCAATCAATCAAAGGG + Intronic
1033313922 7:140282399-140282421 CTGTTTCTCCATCCATAAAATGG - Intergenic
1035934907 8:3826093-3826115 ATGCTTCTGTAACAATAAACCGG + Intronic
1037071497 8:14655940-14655962 ATGGGTCTTCAGCAATAAAAAGG - Intronic
1037370625 8:18173674-18173696 TTGTTTCTTCACCAATAGAATGG + Intronic
1039122730 8:34166619-34166641 TTGCTTATCCACATATAAAATGG - Intergenic
1039271267 8:35883326-35883348 ATCATTCTCCCCAAATAAAAGGG - Intergenic
1039276934 8:35943317-35943339 GTGCTTCTTCCCCAATAAAAAGG + Intergenic
1042093056 8:65180038-65180060 ATGATTCTCAAGCAAGAAAAAGG - Intergenic
1043618702 8:82160561-82160583 ATGCTTTTCAACCAATCAAATGG + Intergenic
1043965856 8:86474146-86474168 AGGCTTCTTCACAAATAATAGGG - Exonic
1045886000 8:107098487-107098509 TTGCTTCTCCTCCAGTGAAAAGG - Intergenic
1046244977 8:111547592-111547614 ATGCTTCTCCATCTGTGAAACGG + Intergenic
1047261956 8:123271497-123271519 ATGCTGCAACACAAATAAAAGGG + Intronic
1047377162 8:124310914-124310936 ATGCTTAGCCACTAAGAAAAAGG + Intergenic
1047882247 8:129208463-129208485 AAGCTTATTCAGCAATAAAAAGG + Intergenic
1047971565 8:130088883-130088905 AAGCTTCTCCAACTATAATATGG - Intronic
1048791846 8:138111488-138111510 CTGTTTCTGCATCAATAAAATGG + Intergenic
1049168981 8:141146366-141146388 ATGTTTCTCAACAAACAAAAGGG - Intronic
1050555240 9:6784185-6784207 CTGCTTCCCCATCAGTAAAATGG - Intronic
1050928777 9:11298980-11299002 ATGATTCTTCAAGAATAAAAGGG + Intergenic
1053346719 9:37383563-37383585 ATGCTCCTCCACCAGGAAAGAGG + Intergenic
1053483019 9:38430257-38430279 TAGCTTCTACACCAAAAAAATGG + Intergenic
1053504936 9:38634198-38634220 ATACTTACCCAGCAATAAAAAGG - Intergenic
1054425239 9:65059982-65060004 ATACTGCTCTACCAATAGAAAGG - Intergenic
1055822449 9:80283312-80283334 ATGCTACAGCACCAAGAAAATGG + Intergenic
1055837872 9:80466153-80466175 ATTTTTCTCCATCAGTAAAAGGG + Intergenic
1056893773 9:90521767-90521789 TTGTTTCTCTACCCATAAAATGG - Intergenic
1057103154 9:92383315-92383337 ATGCTTTCACACAAATAAAATGG - Intronic
1058588620 9:106536855-106536877 CTGGTTTTCCATCAATAAAATGG + Intergenic
1058885342 9:109318763-109318785 CTCCTTTTCCATCAATAAAAAGG + Intronic
1059217239 9:112575573-112575595 ATGCTTCTCCATCAGTAGCAAGG + Intronic
1059736138 9:117101655-117101677 TTATTTGTCCACCAATAAAATGG - Intronic
1060708372 9:125830734-125830756 ATGGTTCTCCTTCTATAAAATGG - Intronic
1061016454 9:127983531-127983553 ACGCTTCTTCACCTGTAAAATGG + Intergenic
1061249242 9:129416844-129416866 GAGCTTCCCCACCTATAAAAGGG - Intergenic
1189181913 X:39012480-39012502 TTACTTCTCCACCTGTAAAATGG - Intergenic
1190454517 X:50614412-50614434 ATGCTTACCAATCAATAAAAGGG + Intronic
1191158697 X:57303583-57303605 CTGTTTCTCCAGCTATAAAATGG - Intronic
1191647364 X:63496425-63496447 ATTCTTGTACACCAATAACAGGG + Intergenic
1192082332 X:68060394-68060416 CTGTTTCTCCATCTATAAAAAGG + Intronic
1192578619 X:72262452-72262474 ATTTTTCTTCACCAGTAAAATGG + Intronic
1194392477 X:93337401-93337423 ATTATTTTCCACCTATAAAATGG + Intergenic
1195715574 X:107815150-107815172 TTGTTTCTTCACCTATAAAATGG + Intergenic
1195784560 X:108505038-108505060 ATGCTACTCAACCACAAAAAAGG + Intronic
1196673386 X:118393203-118393225 CTGCTCCACCACCAAGAAAAAGG + Exonic
1201403271 Y:13626361-13626383 ATGCTACTCCAGCAATACTATGG + Intergenic
1202081906 Y:21092380-21092402 AGCCTTCTCCTCCAATAAATTGG - Intergenic