ID: 1088150972

View in Genome Browser
Species Human (GRCh38)
Location 11:106744580-106744602
Sequence ATGAAAAGTAATAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 879
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 830}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1088150967_1088150972 27 Left 1088150967 11:106744530-106744552 CCTTATCCTTTTGACCTTACATT 0: 1
1: 0
2: 2
3: 17
4: 240
Right 1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 48
4: 830
1088150968_1088150972 21 Left 1088150968 11:106744536-106744558 CCTTTTGACCTTACATTTTTTTG 0: 1
1: 0
2: 2
3: 35
4: 498
Right 1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 48
4: 830
1088150966_1088150972 28 Left 1088150966 11:106744529-106744551 CCCTTATCCTTTTGACCTTACAT 0: 1
1: 0
2: 0
3: 15
4: 219
Right 1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 48
4: 830
1088150970_1088150972 13 Left 1088150970 11:106744544-106744566 CCTTACATTTTTTTGGACATTTT 0: 1
1: 0
2: 5
3: 66
4: 796
Right 1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG 0: 1
1: 0
2: 0
3: 48
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1088150972 Original CRISPR ATGAAAAGTAATAAGCAGGA AGG Intronic
900493473 1:2965069-2965091 ATGAATAGTAGTAAGATGGATGG - Intergenic
901135659 1:6992392-6992414 ATGGAAAGAAATAATCAGAAAGG - Intronic
901335735 1:8447515-8447537 AGGAAAACTAATAAACAGAAAGG - Intronic
901472769 1:9469106-9469128 TTGAAATGTCATATGCAGGATGG + Intergenic
901889040 1:12246259-12246281 TTGAAATGTAATCATCAGGAAGG - Intronic
901903546 1:12388662-12388684 ATAAAAAATAATTAGCAAGATGG + Intronic
902696366 1:18143426-18143448 ATGGAGAGTTCTAAGCAGGAGGG - Intronic
902738791 1:18419760-18419782 ATGCAAGGTAATCAGCACGAGGG - Intergenic
904870971 1:33617948-33617970 GTTAAGAGTAAGAAGCAGGAGGG - Intronic
905205968 1:36343006-36343028 CTGAAAAATGAAAAGCAGGAAGG + Intronic
905698963 1:39997436-39997458 GTGATAATTAATAAGTAGGAGGG + Intergenic
906024355 1:42660285-42660307 CTGAACAGTAATAAGAAGAAGGG - Intronic
906739847 1:48172438-48172460 AGGAAAACTAATAAACAGAAAGG - Intergenic
907770104 1:57452992-57453014 AAGAAAAGAAAAAAGAAGGAGGG + Intronic
908355335 1:63322028-63322050 CTGAAATCTAATTAGCAGGAGGG + Intergenic
908448893 1:64230257-64230279 CTTGAAAGTAATAAGCAGGGTGG - Intronic
908492080 1:64655241-64655263 ATGAAAAGTCAAAGGAAGGAAGG - Intronic
909069257 1:70974704-70974726 ACGAAAAATAATCAGCTGGAGGG - Intronic
909170406 1:72286041-72286063 AAGAAATGTAATAATCAGTAGGG + Intergenic
909558456 1:76981932-76981954 AGGAAAACTAATGAGCAGAAAGG + Intronic
909682755 1:78310964-78310986 ATGAAAACTAACAAACAGAAAGG + Intronic
910036258 1:82792556-82792578 ATGAAAAGTACTGAGCACCAAGG - Intergenic
910743385 1:90546593-90546615 AAGAAAAGAAAGAAGCAGCAGGG + Intergenic
910799641 1:91132148-91132170 AGGAAAACTAACAAGCAGAAAGG + Intergenic
910940722 1:92530706-92530728 AGGAAAACTAACAAGCAGAAAGG + Intronic
911394289 1:97287115-97287137 AGGAAAACTAACAAGCAGAAAGG - Intronic
911469146 1:98294975-98294997 ATCAAAAGTAAAAAGAAGGCCGG - Intergenic
911490060 1:98553240-98553262 AGGAAAACTAACAAGCAGAAAGG + Intergenic
911534391 1:99082743-99082765 AAGGAAAGAAACAAGCAGGAAGG - Intergenic
911867792 1:103050790-103050812 AGGAAAACTAACAAACAGGAAGG - Intronic
911990747 1:104693803-104693825 AGGAAAACTAACAAGCAGGAAGG + Intergenic
912603975 1:110968875-110968897 TTGAAATGTAATCATCAGGAAGG - Intergenic
913337464 1:117721619-117721641 AGGAAAACTAATAAACAGAAAGG + Intergenic
913363044 1:118004033-118004055 AGGAAAAGTAACAAACAGAAAGG - Intronic
913473498 1:119214625-119214647 ATGAAAACTAACAAACAGAAAGG - Intergenic
913584306 1:120258504-120258526 ATGAAAAGGAACATGCAGGCTGG - Intergenic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
913720277 1:121586366-121586388 AGGAAAACTAACAAGCAGAAAGG - Intergenic
914566301 1:148870381-148870403 ATGAAAAGGAACATGCAGGCTGG - Intronic
914606518 1:149259859-149259881 ATGAAAAGGAACATGCAGGCTGG + Intergenic
915026114 1:152831179-152831201 AGGAAAAGTAAAAAACAGAAAGG + Intergenic
915651647 1:157316181-157316203 AGGAAAACTAACAAGCAGAAAGG + Intergenic
915809059 1:158886914-158886936 AGGAAAACTAATAAACAGAAAGG + Intergenic
916007313 1:160674354-160674376 AAAAAAAATAATCAGCAGGATGG + Intergenic
916297685 1:163237694-163237716 AAAAAAAGAAAAAAGCAGGAGGG + Intronic
917015061 1:170520933-170520955 ATGGAAACTATTAAACAGGAGGG + Intergenic
917041683 1:170811680-170811702 AGGAAAACTAACAAGCAGAAAGG + Intergenic
917126917 1:171695588-171695610 AGGAAAACTAATAAACAGAAAGG - Intergenic
917270595 1:173269160-173269182 ATTGAAAGTAATAATCAAGAGGG + Intergenic
917508930 1:175654170-175654192 ATGAAAGGCAATAAGCAAGAAGG - Intronic
917539083 1:175896238-175896260 ATGAAATATTACAAGCAGGATGG + Intergenic
917562842 1:176177870-176177892 AAGATAAGTAAAAAGGAGGAAGG + Intronic
917584870 1:176416393-176416415 AGGAAAACTAACAAGCAGAAAGG - Intergenic
917699380 1:177564541-177564563 AGGAAAACTAATAAACAGAAAGG + Intergenic
917861148 1:179145854-179145876 GTGAACAGTTTTAAGCAGGATGG + Intronic
918483313 1:185002346-185002368 AGGAAAACTAACAAGCAGAAAGG + Intergenic
918506181 1:185256970-185256992 AGGAAAACTAACAAGCAGAAAGG - Intronic
918548127 1:185708330-185708352 AGGAAAAGTAACAAACAGAAAGG + Intergenic
918777120 1:188647856-188647878 ATAGAAAGTACTAAGCAGTATGG + Intergenic
919057634 1:192590770-192590792 ATGAAAAGTCAAAGGCAAGATGG + Intergenic
919623216 1:199886137-199886159 AGGAAAACTAACAAACAGGAAGG - Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
921243803 1:213214829-213214851 ATGAAAACTAACAAACAGAAAGG + Intronic
921258067 1:213360747-213360769 ATGAAAACTAACAAACAGAAAGG - Intergenic
921334264 1:214070655-214070677 ATGAAATGAAATAGGAAGGAAGG + Intergenic
921682182 1:218047099-218047121 ATTAAGAGTAAGAAGCAGAAAGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922124487 1:222709496-222709518 ATGAAAAAAATGAAGCAGGATGG + Intronic
923186060 1:231574663-231574685 ATGAGAAGTGATAAACAGAATGG - Intronic
923235367 1:232027915-232027937 ATGTAAAGTTATAACAAGGAAGG - Intronic
923431613 1:233926855-233926877 AGGAAAACTAACAAGCAGAAAGG - Intronic
923599143 1:235386988-235387010 AGGAAAACTAACAAACAGGAAGG - Intronic
924437272 1:244053311-244053333 AGCAAAAGTAATAAAAAGGATGG + Intronic
924823007 1:247512729-247512751 AGGAAAACTAACAAGCAGAAAGG - Intronic
1066042819 10:31568021-31568043 AGGAAAACTAATAAACAGAAAGG - Intergenic
1066060382 10:31718865-31718887 AGGAAAACTAATAAACAGAAAGG - Intergenic
1066394721 10:35008112-35008134 ATGAAAAGGAAAAAGGAGCAAGG - Intergenic
1066533857 10:36369139-36369161 ATGGAAAGTAATAGGAAGGAAGG + Intergenic
1067197909 10:44138157-44138179 AGGAAAACTAATAAACAGAAAGG + Intergenic
1067579447 10:47433033-47433055 AGGAAAACTAAAAAGCAGAAAGG - Intergenic
1067811809 10:49434184-49434206 AGGAAAAGTAATAAACATGCAGG + Intergenic
1068389406 10:56374559-56374581 ATGAAAAGAAAGAAGCTGTAGGG - Intergenic
1068578809 10:58715082-58715104 ATTAAAAATAATAATTAGGAGGG + Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1070217565 10:74402940-74402962 AGGAAAAGTAACAAACAGAAAGG - Intronic
1070917900 10:80166767-80166789 ATGGACAGTAAGGAGCAGGAGGG - Intronic
1071884638 10:89936730-89936752 AGGAAAACTAATAAACAGAAAGG - Intergenic
1071933985 10:90506052-90506074 ATTAAAAGTGAAAAACAGGATGG - Intergenic
1071998275 10:91168291-91168313 CTGAGAAGAAAGAAGCAGGAGGG + Intronic
1072301006 10:94062271-94062293 ATGAAAAAAAACAAGAAGGAAGG - Intronic
1072383304 10:94898098-94898120 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1072511173 10:96127056-96127078 ATGAAAAGAACTAAGAAAGAGGG + Intergenic
1072573505 10:96678744-96678766 AGGAAAAGTGAAAAGGAGGAAGG - Intronic
1072869298 10:99099944-99099966 ATGAAAACTAACAAACAGAAAGG + Intronic
1073018396 10:100420384-100420406 ATGAAGTGTTTTAAGCAGGAAGG + Intergenic
1073480738 10:103784749-103784771 AGGAGAAGTAAGAAGGAGGAAGG + Intronic
1074372849 10:112914188-112914210 CTGAAAAGAAAGAAGGAGGAAGG - Intergenic
1074650128 10:115512903-115512925 AGGAAAAGGAATAAGCACAAAGG - Intronic
1074684236 10:115944563-115944585 ATGAAAAGCAATAAAAAGCAGGG + Intronic
1075003260 10:118813254-118813276 ATAAAAATAAATAAGTAGGACGG + Intergenic
1077595597 11:3528922-3528944 ATGAGAAGAAATACGCAGGTGGG - Intergenic
1077997617 11:7467566-7467588 ATGAAAAGTAATTAGTTAGAAGG + Exonic
1078032320 11:7765089-7765111 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1078309996 11:10231497-10231519 AGGAAAAGTAACAAACAGAAAGG - Intronic
1078347357 11:10562603-10562625 GTGAAAAGTAATAATCAGACAGG + Intronic
1078387095 11:10902025-10902047 ATTAGAAGTAAAAAGCAGGCCGG - Intergenic
1078697845 11:13652169-13652191 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1078825758 11:14928951-14928973 ATGAAAAGAAATTAGCATGTAGG + Intronic
1078981253 11:16537244-16537266 AGGAAAAGTAACAAACAGAAAGG + Intronic
1079549248 11:21674231-21674253 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1080118047 11:28642198-28642220 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1080522969 11:33083806-33083828 TTAAAAACTAAAAAGCAGGAGGG - Intronic
1080917481 11:36674331-36674353 AGGAAAACTAATAAACAGAAAGG + Intergenic
1081071822 11:38619659-38619681 TAGAAAAGAAATGAGCAGGAGGG + Intergenic
1081193685 11:40135526-40135548 ATGAAAAGCAATAAGGAGCTGGG + Intronic
1081693112 11:45091862-45091884 ATAAAAACAAATAAGCAGGTTGG + Intergenic
1082095220 11:48124463-48124485 ATGAACAGAAAGAAGCAAGAGGG - Intronic
1082103097 11:48190933-48190955 AGGAAAACTAACAAACAGGAAGG - Intergenic
1082112607 11:48293376-48293398 AGGAAAACTAACAAACAGGAAGG + Intergenic
1082125781 11:48429755-48429777 ATGAAAAGGAGTCAGCAGAATGG - Intergenic
1082250643 11:49976452-49976474 ATGAAAAGGAGTCAGCAGAATGG + Intergenic
1082613754 11:55334477-55334499 AGGAAAACTAACAAACAGGAAGG - Intergenic
1082951143 11:58816900-58816922 ATGAAAACTAACAAACAGAAAGG + Intergenic
1083092186 11:60211519-60211541 AGGAAAAGAACTAAGCAGCAAGG + Intronic
1083503369 11:63132502-63132524 ATGAAAACTAACAAACAGAAAGG - Intronic
1083577170 11:63800635-63800657 AAGAAAAGGAAAAAGAAGGAAGG + Intergenic
1084422612 11:69067862-69067884 ATGAAAAGAAAAAGGGAGGAGGG - Intronic
1085087965 11:73685025-73685047 TTGAAAGGTATTAAGCAGAATGG + Intronic
1085433974 11:76482170-76482192 AGGAAAACTAACAAGCAGAAAGG + Intronic
1085913223 11:80853210-80853232 ATGAAAGGTAATAAAAATGAAGG + Intergenic
1086315995 11:85592976-85592998 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
1086342373 11:85859110-85859132 AAAAAAAATAAAAAGCAGGAAGG + Intronic
1086439777 11:86816512-86816534 AGGAAATGTAATAATCAGGCAGG - Intronic
1087721836 11:101674212-101674234 ATAAAAAGAAAGAAGCAGAAAGG + Intronic
1087765647 11:102150278-102150300 GTGCAAAGTAGTAAGCAGGCTGG - Intronic
1087925243 11:103911398-103911420 AGGAAAAGTAACAAACAGAAAGG + Intronic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088654453 11:111986212-111986234 ATGAAAAGTTGTATGCAGAAGGG - Intronic
1088731048 11:112683737-112683759 AGGAAAACTAACAAACAGGAAGG - Intergenic
1088760116 11:112921611-112921633 ATGAAGAGGAATAAGCATGAAGG - Intergenic
1088902615 11:114129511-114129533 ATGAAAGGGAATAGGCAGGTGGG - Intronic
1089337950 11:117738255-117738277 AAGAAAAGTACTAAGAAGGTTGG - Intronic
1089568347 11:119385034-119385056 ATGAAAAGTAAAAAGAGAGAAGG + Intergenic
1090103700 11:123829415-123829437 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1090177811 11:124666897-124666919 ATGAAAGGTAATAATTAGGAGGG - Intronic
1090892395 11:130935983-130936005 ATGAAAAATAAATAGCAAGATGG - Intergenic
1091326489 11:134693009-134693031 AGGAAAATTAATAAACAGAAAGG + Intergenic
1092216013 12:6683317-6683339 ATTAAAAATAATAATTAGGAGGG + Intronic
1092649013 12:10612951-10612973 ATGAAGAGTACCAAGCAAGAGGG - Intronic
1093399320 12:18725294-18725316 AAGAAAAGCAATAAGAAAGAAGG + Intronic
1093470283 12:19494083-19494105 ATTAAAAGTAACAAACAGGTAGG + Intronic
1093673042 12:21900261-21900283 AGGAAAAGTAACAAACAGAAAGG + Intronic
1093908003 12:24714599-24714621 AAGTAATGTAATAAGAAGGAAGG + Intergenic
1093992804 12:25609541-25609563 AGGAAAACTAACAAACAGGAAGG - Intronic
1093998208 12:25665647-25665669 AGGAAAACTAACAAACAGGAAGG - Intergenic
1094004210 12:25730241-25730263 ATCTACAGTAACAAGCAGGAAGG - Intergenic
1094126862 12:27032627-27032649 CTGAAATGTAACAAGAAGGAGGG - Intronic
1094278047 12:28701233-28701255 ATTGAAAATAATAAGCAAGAGGG - Intergenic
1094361312 12:29634306-29634328 ATGGAATGTAATCATCAGGAAGG + Intronic
1094453409 12:30605072-30605094 AGGAAAACTAATAAACAGAAAGG + Intergenic
1094730073 12:33164205-33164227 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1094735432 12:33228510-33228532 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1095119378 12:38397729-38397751 ATTAAATGTAATCAGCAGTAGGG + Intergenic
1095575199 12:43729345-43729367 ATGAAATTTAAAAAGCAGTATGG - Exonic
1095683394 12:45004592-45004614 ATGAAAAGTAAGAAAGAAGATGG - Intergenic
1095737994 12:45578570-45578592 GTGAAAAGCATTAAACAGGATGG + Intergenic
1096526177 12:52211709-52211731 TTGAAGAGTTTTAAGCAGGAAGG + Intergenic
1096816826 12:54207069-54207091 GTGACGAGTACTAAGCAGGATGG - Intergenic
1097098428 12:56568937-56568959 ATGCAAAGTAATAATCTGGGGGG - Intronic
1097148220 12:56956228-56956250 ATGATGAATAAAAAGCAGGAAGG + Intronic
1097304356 12:58052751-58052773 AGGAAAACTAATAAACAGAAAGG + Intergenic
1098120449 12:67231286-67231308 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1098183078 12:67869089-67869111 AGGAAAACTAATAAACAGAAAGG - Intergenic
1098498162 12:71161058-71161080 ATGAATAGTAATTGGCATGATGG - Intronic
1098668799 12:73198824-73198846 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1098927065 12:76362064-76362086 ATAATATGTAATAAGCAGGCAGG + Intronic
1099655783 12:85488521-85488543 AGGAAAAATAATAAACAGGAGGG - Intergenic
1099718556 12:86331097-86331119 ATTAAAAGTTATAAGAAGGAAGG + Intronic
1100616011 12:96232272-96232294 ATGAAAAGTTAAAAGCTGGCTGG + Intronic
1100758439 12:97778002-97778024 AGGAAAAGAAAAAAGAAGGAAGG - Intergenic
1100900883 12:99238836-99238858 AGGAAAACTAATAAACAGAAAGG + Intronic
1101622148 12:106398785-106398807 AGGAAAACTAACAAACAGGAAGG + Intronic
1101697687 12:107141679-107141701 ATGGAAAGATATAGGCAGGAAGG - Intergenic
1101753365 12:107601604-107601626 ATGCAGAGTGATCAGCAGGATGG + Intronic
1102265323 12:111479254-111479276 ATAAAAAGGAATAAGCTGGCTGG + Intronic
1102384335 12:112494852-112494874 ATGAAAAGTGAAAAACAGAATGG - Intronic
1102583271 12:113905566-113905588 ACAAAAAGTTATAACCAGGAAGG + Intronic
1103689691 12:122761521-122761543 ATCAAAAGAAATAACCAGGCTGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104006147 12:124893940-124893962 AAGAAAAAGAAAAAGCAGGAAGG + Intergenic
1104501212 12:129287326-129287348 ATGTAAATTAATAAACAGGAAGG + Intronic
1104575547 12:129963021-129963043 AAAAAAATTAAAAAGCAGGAGGG - Intergenic
1106608180 13:31251135-31251157 AGGAAAACTAATAAACAGAAAGG + Intronic
1106774558 13:32996386-32996408 CTGAAATGGAATAAGCAGGGTGG - Intergenic
1106953281 13:34908010-34908032 CTGAAAGGTTTTAAGCAGGAAGG - Intergenic
1106991595 13:35427322-35427344 AGGAAAACTAACAAACAGGAAGG - Intronic
1107317240 13:39146242-39146264 ACAAAAAGTAATAATAAGGAAGG + Intergenic
1107477661 13:40755043-40755065 ATAAAAAATAATAAACTGGAGGG + Intronic
1107558481 13:41539934-41539956 AGGAAAACTAACAAACAGGAAGG - Intergenic
1107857100 13:44627094-44627116 ATGAAAAGTAATGAAGAGTAAGG - Intergenic
1108048700 13:46408285-46408307 ATGAAAACTAACAAACAGAAAGG - Intronic
1108308484 13:49162830-49162852 AGGAAAACTAACAAACAGGAAGG - Intronic
1108988852 13:56629615-56629637 AAGAAAACTAATAAACAGAAAGG + Intergenic
1109333689 13:60964508-60964530 ATGAAAAGTAATATTCTGAAAGG + Intergenic
1109365244 13:61346782-61346804 ATTAAAAGAACAAAGCAGGAAGG + Intergenic
1109541233 13:63781630-63781652 ATGAAAACTAACAAACAGAAAGG - Intergenic
1109669508 13:65586086-65586108 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1110642721 13:77844101-77844123 ATTAAAAGTAATGTGCATGAAGG - Intergenic
1110841881 13:80152717-80152739 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1111209548 13:85060154-85060176 ATGAAAATTAAAAAGAAGGCCGG + Intergenic
1112578569 13:100659167-100659189 ATGAAAAGGAATTAGGGGGATGG + Intronic
1112976704 13:105328793-105328815 ATGCAAAGTAAGTACCAGGATGG - Intergenic
1112977793 13:105342303-105342325 ATGAAAACCAAGGAGCAGGACGG - Intergenic
1113390742 13:109893955-109893977 CTGGAAAGCAATGAGCAGGAGGG + Intergenic
1114151452 14:20044555-20044577 ATGTCAAATAATAATCAGGACGG - Intergenic
1114166191 14:20220725-20220747 ATTAATAATAATAAGCAGGAAGG + Intergenic
1114310904 14:21466186-21466208 ACTAAAAATAATTAGCAGGATGG + Intronic
1114316423 14:21513827-21513849 ATGAACAGTAATGAAAAGGAAGG + Intergenic
1114398235 14:22386247-22386269 ATGAACAGTAATATTAAGGAGGG + Intergenic
1114782363 14:25552225-25552247 TTGAAAAATAATATGGAGGATGG + Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115114830 14:29867618-29867640 TTGAAAAGTTTTAAGCAGGACGG + Intronic
1115184029 14:30664319-30664341 AGGAAAACTAACAAGCAGAAAGG + Intronic
1115895882 14:38086392-38086414 ATGAACAGTTACAAGCATGATGG + Intergenic
1116093914 14:40343025-40343047 AAGAAAATTAACAAGAAGGAAGG - Intergenic
1116188065 14:41624889-41624911 AAAAAAATTAAGAAGCAGGAGGG - Intronic
1116962524 14:50981306-50981328 ATGAATCGTAATAAGAAGAATGG + Intronic
1117123597 14:52596038-52596060 AGGAAAACTAATAAACAGAAAGG - Intronic
1117199410 14:53373021-53373043 ATGCAAAATAACAAGCAGCAAGG - Intergenic
1117489262 14:56229543-56229565 AGGAAAAGTAACAAACAGAAAGG + Intronic
1117549570 14:56820594-56820616 ATGAAAAGTATTAATCAATATGG - Intergenic
1117655573 14:57952208-57952230 AGGAAAACTAACAAACAGGAAGG + Intronic
1117796955 14:59404936-59404958 AGGAAAACTAAAAAGCAGAAAGG - Intergenic
1118079829 14:62345794-62345816 ATGAAAAGTAAAAAGCAAACTGG - Intergenic
1118094598 14:62522028-62522050 AGGAAAACTAACAAACAGGAAGG + Intergenic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118586390 14:67357886-67357908 TTGAAACGTAATCATCAGGAGGG - Intronic
1118716948 14:68566853-68566875 TTGAAGAGTAATAAGAAAGAAGG - Intronic
1118866112 14:69704905-69704927 ATGCAAAGCAATAAGCACAATGG - Intronic
1119109356 14:71957239-71957261 ATGAGAAGGCATAAGCAGGAGGG + Intronic
1119286772 14:73461549-73461571 AAGAAAAGAAAAAAGCTGGATGG - Intronic
1119575237 14:75715015-75715037 ATGAAAAGCAAAAAACAAGAAGG - Intronic
1120084219 14:80250874-80250896 AGGAAAACTAATAAACAGAAAGG - Intronic
1120114297 14:80595473-80595495 AAAAAAATTAATAAACAGGAAGG + Intronic
1120565230 14:86047553-86047575 AGGAAAACTAACAAACAGGAAGG - Intergenic
1120851047 14:89170860-89170882 ATAGAATGTAATAAGCAGTAGGG + Intronic
1121187623 14:91989900-91989922 AAGGAAAGTCACAAGCAGGATGG - Intronic
1122515421 14:102305011-102305033 CGGAAAAGAAAGAAGCAGGAAGG + Exonic
1202936972 14_KI270725v1_random:97953-97975 AAGAAAAGTAAAGAGGAGGAGGG + Intergenic
1123429140 15:20200051-20200073 AGGAAAACTAACAAACAGGAAGG - Intergenic
1124133631 15:27012882-27012904 ATGAATAGTGGTAAGCAGAAAGG + Intronic
1124561339 15:30776091-30776113 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1125109810 15:36019216-36019238 AAGAAAAGTAGTATCCAGGAAGG + Intergenic
1125138669 15:36376294-36376316 ATTAAAAGAAATAATCAGGCCGG - Intergenic
1125339554 15:38661148-38661170 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
1125864481 15:43032715-43032737 ATGAAAAATACTAGGCTGGATGG - Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128224234 15:65990637-65990659 AGGAAAAGAAAAAAGAAGGAAGG + Intronic
1128405264 15:67330762-67330784 AGGAAAACTAAGAAGCAGAAAGG - Intronic
1129481696 15:75831588-75831610 TTGAAATGTAATAAGCAAGAAGG + Intergenic
1129631071 15:77261074-77261096 AGGAAAACTAATAAACAGAAAGG + Intronic
1129954795 15:79626299-79626321 CTTAAAAGTAATAACCAAGAAGG + Intergenic
1130633663 15:85595978-85596000 ATGAAATGAAAGAGGCAGGAAGG - Intronic
1130729418 15:86475026-86475048 AGGAAAACTAATAAACAGAAAGG + Intronic
1131368860 15:91863095-91863117 ATGAAAATTTCTAAGCAGCATGG + Intronic
1131407723 15:92179780-92179802 TTGAAAAGCAAAAAGCAGGTAGG - Intergenic
1132195610 15:99912537-99912559 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1133471975 16:6084220-6084242 ATAAAAATAAATAAGGAGGAAGG - Intronic
1133770404 16:8864440-8864462 TTGTAAAGTAGTAAGCAGAATGG - Intronic
1133904343 16:10007874-10007896 ATGGAAGGTCCTAAGCAGGAAGG + Intronic
1135521513 16:23182187-23182209 AGGAAAAGAAAGAAGAAGGAAGG + Intergenic
1135631105 16:24036150-24036172 ATGATAATTAGAAAGCAGGATGG + Intronic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136855180 16:33649681-33649703 AGGAAAACTAACAAACAGGAAGG + Intergenic
1138692803 16:58785062-58785084 AGGAAAACTAACAAACAGGAAGG - Intergenic
1138893013 16:61167926-61167948 ATGAAAAGTAAAAATCTGGGGGG + Intergenic
1138927621 16:61611726-61611748 ATGAAAAAAAATAAGCATGAGGG + Intergenic
1139043385 16:63028077-63028099 CTGAAAGGTTTTAAGCAGGAAGG - Intergenic
1139399776 16:66672113-66672135 ATTAAAAGTAATGACCAGGCCGG + Intronic
1139736468 16:68993860-68993882 CAGAAATGTAATAATCAGGAAGG - Intronic
1140168235 16:72576779-72576801 ATGATAAAGTATAAGCAGGAAGG + Intergenic
1140322940 16:73971412-73971434 TTGAAAAGTAATAGGCTGGTAGG - Intergenic
1140357121 16:74316015-74316037 ATGAAAAAATATAAGCAGGCCGG + Intergenic
1141246292 16:82310701-82310723 ATGATCAGGATTAAGCAGGATGG - Intergenic
1142435009 16:90050956-90050978 TTGAAAGGTAATCATCAGGAAGG - Intergenic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1203116762 16_KI270728v1_random:1498165-1498187 AGGAAAACTAACAAACAGGAAGG + Intergenic
1142599327 17:1045855-1045877 AAGAAAAGAAAACAGCAGGAGGG - Intronic
1142935238 17:3324548-3324570 AGGAAAACTAACAAACAGGAAGG - Intergenic
1143531400 17:7506742-7506764 ATAAAAAGTAATGAACAGGCTGG + Intronic
1143710441 17:8730842-8730864 ATGAAAAGGATTTAGCAGGCAGG + Intronic
1143812593 17:9484465-9484487 AAGAACAGTAATTGGCAGGAGGG + Intronic
1144188039 17:12814806-12814828 ATCAAAAGTAAAAATAAGGAGGG - Intronic
1144313041 17:14031138-14031160 AGGAAAAGAAAAAAGCAGGGTGG + Intergenic
1144315973 17:14061965-14061987 AGAAAAAGGAAAAAGCAGGAGGG - Intergenic
1144556801 17:16289667-16289689 TTGAAAAGTCATAAGTAGCAAGG + Intronic
1144630396 17:16869153-16869175 AAAAAAATTATTAAGCAGGAGGG - Intergenic
1144994192 17:19255922-19255944 ATAAAAAATAAAAAACAGGAGGG - Intronic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1146145411 17:30412080-30412102 AGGAAAATTAACAAACAGGAAGG - Intronic
1146580304 17:34031314-34031336 AGGAAAACTAACAAACAGGAAGG + Intronic
1146740022 17:35275307-35275329 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1148180709 17:45602580-45602602 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1148268194 17:46243346-46243368 AAGAAAAGAAAGAAGAAGGAAGG + Intergenic
1149212290 17:54317282-54317304 AGGAAAACTAATAAACAGAAAGG + Intergenic
1149359457 17:55878528-55878550 AGGAAAACTAATAAACAGAAAGG - Intergenic
1150453962 17:65292357-65292379 ATCAAAAGCACTAAGGAGGAAGG + Intergenic
1150677836 17:67259937-67259959 AAGAAAAGAAAAAAGGAGGAGGG + Intergenic
1151083643 17:71357139-71357161 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1152840774 17:82566722-82566744 ATGAAAAGAAAGCAGCAGGTGGG - Intronic
1152929546 17:83102875-83102897 AAGAAAAGAAATGAGCAGGTGGG + Intergenic
1153384663 18:4478142-4478164 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1155232490 18:23786983-23787005 ATGAAAATAAATAAACAGGCCGG + Intronic
1155294490 18:24372563-24372585 GTGAAAAGGAGAAAGCAGGAAGG - Intronic
1155554580 18:27004291-27004313 ATGAAAAGAATCAAGCAGGGCGG + Intronic
1156282352 18:35652336-35652358 ATGAAAAGTCAGAGGAAGGAAGG - Intronic
1156314675 18:35957542-35957564 AAAAAAAGAAAGAAGCAGGAAGG + Intergenic
1156314696 18:35957702-35957724 AAAAAAAGAAAGAAGCAGGAAGG + Intergenic
1156393732 18:36678121-36678143 AAGAAAAGTAAAAAGCATAAGGG - Intronic
1156725216 18:40119250-40119272 ATGAAAACTAACAAACAGAAAGG - Intergenic
1157058164 18:44255481-44255503 AGGAAAACTAATAAACAGAAAGG - Intergenic
1157822380 18:50782541-50782563 ATTAAAAGTAAGAAACAGGCTGG + Intergenic
1158168939 18:54574688-54574710 AAGAAAACTAACAAACAGGAAGG - Intergenic
1158243608 18:55405751-55405773 AGGAAAAGAAAGAGGCAGGAGGG + Intronic
1158853481 18:61518540-61518562 ATGAAAACTAACAAACAGAAAGG + Intronic
1159582862 18:70252036-70252058 ATGAAAAGTAAAAATCAAGATGG + Intergenic
1159783495 18:72687034-72687056 ATGAAAAATAATATGCAGTTTGG + Intergenic
1160038927 18:75326745-75326767 ATGCAAAGCAAGCAGCAGGAAGG + Intergenic
1160252722 18:77217533-77217555 ACCAAAAGTAATAAGCGAGAAGG - Intergenic
1161378645 19:3952909-3952931 AAGAAAAGAAAAAAGCAGGCCGG - Intergenic
1161529415 19:4778424-4778446 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
1161854885 19:6758606-6758628 ATGAAAATTAAAACACAGGAAGG - Intronic
1162251331 19:9446232-9446254 CTGAAAAGTAAATAGCAGCAGGG - Intergenic
1162986509 19:14273791-14273813 ATAAAAGGAAATGAGCAGGACGG - Intergenic
1164085550 19:21899170-21899192 AGGAAAATTAACAAGCAGAAAGG - Intergenic
1164321532 19:24152738-24152760 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1164615163 19:29663338-29663360 AGGCAGAGTAATAACCAGGAGGG - Intergenic
1164688573 19:30189856-30189878 AGGAAAACTAACAAACAGGAAGG - Intergenic
1164788158 19:30953579-30953601 ATCAAAAGAAATATACAGGATGG - Intergenic
1165141280 19:33701370-33701392 ATGAAAAATAATGAGCATGTAGG + Intronic
1165373748 19:35426864-35426886 AGGGAAAGCAAGAAGCAGGATGG - Intergenic
1166096117 19:40540386-40540408 ATTAAAATTAAAAAGCAGCATGG - Intronic
1166322581 19:42027788-42027810 ATGAAAAGTGAGTAGGAGGAGGG - Intronic
1168159443 19:54499603-54499625 AAGAAGAGTCAGAAGCAGGAAGG + Intronic
1168479091 19:56702544-56702566 AAGAAAAGAAATAAGGAGCAGGG + Intergenic
925252353 2:2450910-2450932 AGGAAAACTAACAAACAGGAAGG - Intergenic
925675750 2:6359344-6359366 ATGAAAAATAAGCAGCTGGAGGG + Intergenic
925936309 2:8765113-8765135 ATGAAAAGTAAACAGTAAGAGGG + Intronic
926346706 2:11953650-11953672 ATGGAAAGAAATAAGAAGGAAGG + Intergenic
926597999 2:14811786-14811808 ATGAAATGTAAGAAGGAGGTAGG + Intergenic
926763736 2:16303931-16303953 ATGAAAGGTGTTAAGCAGGCTGG - Intergenic
927584112 2:24283049-24283071 ATGAAAAGAAAAAAGCATGGGGG - Intronic
927617260 2:24611738-24611760 ATGAAAAATAAAAAGGAGCAGGG - Intronic
928409784 2:31046043-31046065 ATGAAAAGTGATTAGCACAATGG - Intronic
928494320 2:31816451-31816473 ATGAGAAATAATCAGAAGGATGG - Intergenic
928750762 2:34467431-34467453 AGGAAAACTAACAAGCAGAAAGG + Intergenic
929068943 2:38009900-38009922 AGGAAAACTAATAAACAGAAAGG - Intronic
929286792 2:40144211-40144233 AAGAAAAGAAAGAAACAGGAAGG + Intronic
929357909 2:41049013-41049035 ATGAAAAATATTCACCAGGAAGG - Intergenic
929526992 2:42713712-42713734 ATGTTAAGTAAAAAGCAGCAAGG - Intronic
930143237 2:47974442-47974464 AGGAAAACTAACAAACAGGAAGG + Intergenic
930236227 2:48891245-48891267 AAGAAAAGAAGGAAGCAGGAAGG - Intergenic
930271665 2:49264433-49264455 ATTAGAAGTTTTAAGCAGGATGG + Intergenic
930866050 2:56122976-56122998 AGGAGAATTAATAAGAAGGAAGG + Intergenic
930893788 2:56421980-56422002 AGGAAAAGTAAAAAACAGAAAGG + Intergenic
931130231 2:59327245-59327267 ACGAAAACTAACAAACAGGAAGG + Intergenic
931133425 2:59366419-59366441 AGGAAAAATAATAAACATGATGG + Intergenic
931729026 2:65136804-65136826 AAGAAGAGTAATGAGAAGGAAGG + Intergenic
931860726 2:66352068-66352090 AGGAAAACTAACAAGCAGAAAGG - Intergenic
931885666 2:66614823-66614845 AGGAAAACTAACAAGCAGAAAGG - Intergenic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932393227 2:71416667-71416689 AGGAAAACTAACAAGCAGAAAGG - Intronic
932509662 2:72272844-72272866 ATTAAAAGTACAAAGCAGGTGGG + Intronic
932740152 2:74284986-74285008 AGGGAAAGTAACAAGCAGGCTGG - Intronic
932860919 2:75290406-75290428 AAGCAAAGTATTAAGCAGTATGG + Intergenic
933405001 2:81846749-81846771 ATGAAAAGGAAAAAGGAGAATGG - Intergenic
933618562 2:84510763-84510785 AGGAAAACTAACAAGCAGAAAGG - Intergenic
934693462 2:96379915-96379937 AGGAAAACTAACAAGCAGAAAGG + Intergenic
934927642 2:98392602-98392624 AAGAAAAGAAGTAAGCAGGCCGG + Intronic
935604649 2:104958831-104958853 AGGAAAACTAACAAGCAGAAAGG - Intergenic
935606630 2:104977946-104977968 CTGAAAAGAAATAATCATGAGGG + Intergenic
936651964 2:114438211-114438233 ATGAAAAATAAGCAGCAGTAGGG + Intergenic
936806345 2:116337027-116337049 AGGAAAACTAATAAACAGAAAGG - Intergenic
937009206 2:118546544-118546566 AAGAGGAGTCATAAGCAGGAGGG - Intergenic
937074984 2:119096642-119096664 ATGAAAACTAACAAACAGAAAGG + Intergenic
937606104 2:123803769-123803791 AGGAAAACTAACAAGCAGAAAGG - Intergenic
938167412 2:129043333-129043355 ATGAAAACTAACAAACAGAAAGG - Intergenic
938872464 2:135494322-135494344 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
939013614 2:136875996-136876018 ATGAAAACTAAAGAGAAGGAGGG - Intronic
939239282 2:139538008-139538030 AGGAAAACTAATAAACAGAAAGG - Intergenic
939502718 2:143006859-143006881 AGGAAAACTAACAAGCAGAAAGG + Intronic
939674725 2:145058400-145058422 ATGAAAAGTTGTGAGAAGGAAGG + Intergenic
939820450 2:146950386-146950408 ATGAAAAGTAATATGAAGCGGGG + Intergenic
939997140 2:148930501-148930523 ATGAAAAACACTAAGCTGGAAGG - Intronic
940059554 2:149550265-149550287 AGGAAAACTAACAAGCAGAAAGG - Intergenic
940164921 2:150760473-150760495 CTGAAAAGGACTAAGGAGGAGGG - Intergenic
940184480 2:150968365-150968387 ATGAAAAGTGATAAAAATGAGGG + Intergenic
941149712 2:161899082-161899104 ATCAATAGTAATGAACAGGAAGG - Intronic
941262370 2:163313869-163313891 TTGAAAAGTAATTAGCATGAAGG + Intergenic
941285181 2:163602822-163602844 ATGAAAAGGAATATTCAGTAGGG + Exonic
941937495 2:170996293-170996315 ATTAAAAGTAATAATAAGGCTGG - Intronic
941957278 2:171217530-171217552 ATGAAAAGCAGACAGCAGGAGGG + Intronic
942734262 2:179092592-179092614 AGGAAAACTAACAAGCAGAAAGG - Intergenic
942779999 2:179630442-179630464 AGGAAAACTAATAAACAGAAAGG + Intronic
943303494 2:186231268-186231290 AGGAAAACTAACAAACAGGAAGG + Intergenic
944319281 2:198318589-198318611 ATGAAAAGTAATCAGCAAAGAGG + Intronic
944644737 2:201767435-201767457 ATGAAAAGTATTAAGAACAAAGG - Intronic
944758875 2:202792506-202792528 ATAAAAAGTAATAAACTGGCCGG + Intronic
944834215 2:203562335-203562357 ATGAAAGCAGATAAGCAGGAAGG - Intergenic
945074696 2:206026248-206026270 GTTAAAAGTAATAACCAGGCAGG + Intronic
945351454 2:208785215-208785237 AGGAAAAGTAACAAACAGAAAGG + Intronic
945360940 2:208894872-208894894 AGGAAAACTAATAAACAGAAAGG + Intergenic
945873615 2:215253907-215253929 AGGAAAACTAACAAGCAGAAAGG + Intergenic
946050514 2:216858490-216858512 AGGAAAGGGTATAAGCAGGAAGG - Intergenic
1169707909 20:8527386-8527408 ATGAAAATAAATAAACAGCATGG + Intronic
1169743739 20:8922045-8922067 AGGAAAAGTAAGTAGAAGGATGG + Intronic
1170174839 20:13457340-13457362 ATAAAATGTAAAAAGCAGGATGG + Intronic
1170498902 20:16954380-16954402 ATGAAAAGTAAAAGGCAAAAGGG + Intergenic
1170626246 20:18032351-18032373 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
1170633501 20:18084988-18085010 ATGAAAAGCTTTGAGCAGGAGGG + Intergenic
1171352386 20:24513078-24513100 AGGAAAACTAATAAACAGAAAGG + Intronic
1173739770 20:45390844-45390866 CTGAAATGGAATAAGCAGGTTGG + Intronic
1174254473 20:49244011-49244033 ATGAAAGCTAATCAGCAAGAAGG - Exonic
1174855220 20:54038275-54038297 ATAAACAGGAGTAAGCAGGAGGG - Intronic
1176586343 21:8591024-8591046 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1177436278 21:21057573-21057595 ATGACAAGTAACGATCAGGAAGG - Intronic
1177778293 21:25594581-25594603 ATGTAAAATAACAAGCAGTAAGG - Intronic
1178593301 21:33930775-33930797 AGGAAAACTAATAAACAGAAAGG - Intergenic
1179005875 21:37513628-37513650 AGAAAAAGTAAAAAGCAGGAAGG - Intronic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1180017054 21:45094014-45094036 AAAAAAAGTTATAATCAGGATGG - Intronic
1180269149 22:10567927-10567949 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1180394901 22:12322672-12322694 AGGAAAACTAATAAACAGAAAGG - Intergenic
1180404841 22:12542076-12542098 AGGAAAACTAATAAACAGAAAGG + Intergenic
1180414719 22:12698190-12698212 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1180419756 22:12802273-12802295 AGGAAAACTAACAAACAGGAAGG + Intergenic
1181451578 22:23026257-23026279 ATGCAAATTAATAAGGAAGAAGG + Intergenic
1182023516 22:27100281-27100303 GGGAAGAGAAATAAGCAGGATGG + Intergenic
1182203471 22:28598212-28598234 CTTAAAAGTAACAAGCAGGCCGG + Intronic
1182722380 22:32413906-32413928 ATGAAAACCAATATGCAGGTAGG + Exonic
1182733784 22:32516116-32516138 ATGAAAAGCAGTGAGCAGAATGG + Intronic
1203324425 22_KI270738v1_random:515-537 AGGAAAACTAACAAGCAGAAAGG - Intergenic
949399394 3:3649844-3649866 ATGACAATTAATTAGCAGGATGG - Intergenic
949594484 3:5530193-5530215 AGGAAAACTAATAAACAGAAAGG - Intergenic
951173760 3:19575145-19575167 ACTGAAAGTAATAAACAGGATGG + Intergenic
951196995 3:19835714-19835736 ATAAAATGTGATAATCAGGAAGG - Intergenic
951237608 3:20253905-20253927 AGGAAAACTAACAAGCAGAAAGG - Intergenic
951463028 3:22971223-22971245 ATGACAAGAAATAGCCAGGAGGG + Intergenic
951684573 3:25329458-25329480 AGGAAAACTAATAAACAGAAAGG + Intronic
952063494 3:29539496-29539518 ATTAGATGTAATAAGCTGGAGGG - Intronic
952153419 3:30617623-30617645 ATAAAATGTAATATTCAGGAAGG - Intronic
952182485 3:30932811-30932833 ATGAAAAATAAAATGCAGAAAGG - Intergenic
952277690 3:31893034-31893056 ATAAAAAGTAAGAGCCAGGAAGG + Intronic
952558354 3:34559677-34559699 ATGAAAAAAAATAGGAAGGAAGG - Intergenic
952833947 3:37588634-37588656 TTGCAAAGAAATAACCAGGAGGG + Intronic
953289420 3:41647382-41647404 AGGAAAACTAACAAACAGGAAGG - Intronic
953592071 3:44267589-44267611 ATCAAAAGTACTAAGTAGGCTGG - Intronic
954179179 3:48868076-48868098 AAGAAAAGAAACAAGCAGGGCGG + Intronic
954762225 3:52883794-52883816 AAGAAAAATAATAAGCACAATGG - Intronic
955242235 3:57188283-57188305 TTGAAAAGAGATATGCAGGAAGG - Intergenic
955886741 3:63607548-63607570 ATGAAAAGTAAAAAGAAGAAAGG + Intronic
956243518 3:67155192-67155214 AGGAAAACTAATAAACAGAAAGG + Intergenic
956310767 3:67877088-67877110 ATGAAAAGAAATAAGAAAGTGGG - Intergenic
956680318 3:71773274-71773296 ATAAAAAGTACTGAGCAGGCCGG - Intronic
956814058 3:72891733-72891755 ATGAAAAGTCATAAAGAAGAGGG + Intronic
956908484 3:73791848-73791870 CTGAAATGTCATAAGTAGGAAGG - Intergenic
957120728 3:76088005-76088027 ATTAAAAGTAAAAATTAGGATGG + Intronic
957532641 3:81460291-81460313 AAGAAAAGAAAAAAGAAGGAAGG - Intergenic
957565500 3:81879063-81879085 AGGAAAACTAACAAGCAGAAAGG + Intergenic
957989418 3:87610716-87610738 ATAAAAACTAGTAAGCAGGTTGG - Intergenic
958479812 3:94631541-94631563 ATGAAAACTAACAAACAGAAAGG + Intergenic
958530420 3:95323084-95323106 ATGAAAACTCATAAGAGGGAGGG - Intergenic
958752194 3:98204566-98204588 ATGCAAAGAGAGAAGCAGGAAGG - Intergenic
958829831 3:99073711-99073733 ATGAAAACTAATGAACAGAAAGG - Intergenic
959003555 3:100993120-100993142 TTGAAAAGTAAATAACAGGAGGG + Intronic
959100986 3:102009141-102009163 AGGAAAACTAACAAACAGGAAGG + Intergenic
959428577 3:106223608-106223630 AGGAAAACTAACAAACAGGAAGG - Intergenic
959569780 3:107870720-107870742 AAGAAAATTAAAAAGAAGGAAGG - Intergenic
959771730 3:110107132-110107154 ATTAAACGTCATCAGCAGGAGGG - Intergenic
960173966 3:114495725-114495747 AGGAAAAGAAATGAGGAGGAAGG + Intronic
960890738 3:122444823-122444845 AGGAAAACGAATAAGCAGAAAGG + Intronic
960927711 3:122812324-122812346 AGGAAAAGTAAAGAGAAGGAAGG + Intronic
961363832 3:126386717-126386739 CTGAAAGCTAATAAGCAGGTGGG + Intergenic
961689258 3:128656629-128656651 ATGAGAAGTAGGAACCAGGAGGG + Intronic
962341382 3:134587414-134587436 AGGAAAACTAATAAACAGGAAGG - Intergenic
962421359 3:135231942-135231964 CTGGAAAGAAATAAGCAGCAGGG + Intronic
962551467 3:136496870-136496892 ATGAAAAGAGAAAAGCGGGAAGG + Intronic
962761468 3:138518634-138518656 AGGAAAACTAACAAACAGGAAGG + Intronic
962926122 3:139994883-139994905 AGGAAAAGAAATAAGAAGGAAGG - Intronic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
963857005 3:150265060-150265082 ATGAAATTTAAGAAGCAGTACGG + Intergenic
963981906 3:151547230-151547252 ATGAAAACTATTAAAAAGGATGG - Intergenic
964281391 3:155070521-155070543 ATGAAAAGGATTAAGAATGATGG + Intronic
964500301 3:157340976-157340998 AGGAAAACTAACAAACAGGAAGG + Intronic
964623380 3:158736520-158736542 ATGGAAAGTCATAAGCAAGAGGG + Intronic
964715186 3:159714241-159714263 ATAAAAAATAATAAAAAGGAAGG + Intronic
964942500 3:162176508-162176530 ATGATAAATAATAAGCAATATGG + Intergenic
965410826 3:168328524-168328546 AAGAAAAGGAATGAGCAAGATGG + Intergenic
966103480 3:176305674-176305696 ATGAAATGTAATAAAAAAGAAGG + Intergenic
966220694 3:177548351-177548373 GTGAAAAGGAGTAAACAGGAGGG - Intergenic
967384681 3:188899767-188899789 TTGAAAGGTAATCATCAGGAAGG + Intergenic
967471247 3:189864675-189864697 ATAAAAAGAAGGAAGCAGGAAGG - Intronic
967614164 3:191545507-191545529 ATCAAATGTTATAAGAAGGAGGG - Intergenic
967764748 3:193266724-193266746 ATGAAAAGTAATATCCACTATGG - Intronic
968931776 4:3583879-3583901 ATGAAGAATAAAAAGCGGGAAGG - Intronic
969181212 4:5443790-5443812 AGGAAAACTAATAAACAGAAAGG - Intronic
970225096 4:13849539-13849561 ATGCAACTTAATAAGCAAGAAGG + Intergenic
970954839 4:21798253-21798275 ATGAGAAATAAAATGCAGGATGG + Intronic
971007108 4:22387775-22387797 ATTAAAAGCAATGGGCAGGAGGG - Exonic
971188819 4:24407219-24407241 ATGAAGAGTAATGAGCAAAATGG - Intergenic
971201671 4:24514931-24514953 ATGAAAAGTGTGAAGCAGGAGGG + Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971825899 4:31622116-31622138 ATAAATAGTAAAAAGAAGGATGG - Intergenic
971919443 4:32917820-32917842 AAGAAAAGAAAGAAGGAGGAAGG - Intergenic
972677573 4:41275609-41275631 ATGAAAACTAACAAACAGAAAGG - Intergenic
973111792 4:46405594-46405616 AGGAAAACTAATAAACAGAAAGG + Intronic
973313032 4:48729661-48729683 AGGAAAACTAATAAACAGAAAGG + Intronic
973612479 4:52649276-52649298 ATGAAAACTAACAAGCATGAAGG + Intronic
973656845 4:53056832-53056854 AGGAAGAGTAATAATGAGGAAGG + Intronic
974100250 4:57408380-57408402 AATAAAAATTATAAGCAGGAAGG + Intergenic
974180990 4:58384779-58384801 ATGGAAAGTAAAAAGAAGCAGGG - Intergenic
974280130 4:59781056-59781078 AGGAAAACTAACAAGCAGAAAGG + Intergenic
974780450 4:66546018-66546040 AGGAAAACTAACAAACAGGAAGG + Intergenic
974946382 4:68534261-68534283 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
975061840 4:70012858-70012880 AAGAAAAGAAATAACCAAGATGG - Intergenic
975062348 4:70018838-70018860 AGGAAAACTAATAAACAGAAAGG - Intergenic
975096750 4:70465171-70465193 AGGAAAACTAATAAACAGAAAGG + Intronic
975291265 4:72680169-72680191 AGGAAAAGTAACAAACAGAAAGG + Intergenic
975367465 4:73545356-73545378 AAGAAAACTAATAAACAGAAAGG + Intergenic
975431000 4:74290749-74290771 CAGAAAAGTAATGAGGAGGATGG - Intronic
975461412 4:74657762-74657784 TTGAAAAGTAATAGACATGAAGG - Intergenic
975638895 4:76478901-76478923 AGGAAAACTAATAAACAGAAAGG + Intronic
975712613 4:77175449-77175471 TTGAAATGTAATTATCAGGAAGG + Intronic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975865882 4:78723275-78723297 ATGCAAAGTAGTGAGCTGGATGG - Intergenic
976342084 4:83957373-83957395 ATGAAAACTAACAAACAGAAAGG - Intergenic
976364481 4:84217872-84217894 ATGAAAAGGAAAAAACAGAAAGG - Intergenic
976477862 4:85505942-85505964 AGGAAAACTAACAAGCAGAAAGG - Intronic
976491196 4:85672561-85672583 ATGAAGAGTAATAATCACGCTGG - Intronic
976638636 4:87313399-87313421 AGGAGAAGAAAAAAGCAGGAAGG - Intronic
976669611 4:87637093-87637115 AGGAAAACTAATAAACAGAAAGG + Intergenic
976794836 4:88920503-88920525 AGGAAAACTAATAAACAGAAAGG + Intronic
976968753 4:91078376-91078398 AGGAAAAGTAACAAACAGAAAGG + Intronic
976977197 4:91179999-91180021 AGGAAAACTAATAAACAGAAAGG - Intronic
977199631 4:94099850-94099872 AGGAAAACTAACAAGCAGAAAGG + Intergenic
977287018 4:95120658-95120680 AAGAAAAGAAAGAAGAAGGAAGG - Intronic
977513518 4:97992058-97992080 GGGAAAAGTAATAATCAGCAGGG - Intronic
977539701 4:98301847-98301869 ATGAAAAGAAAGAAGCAAGAGGG + Intronic
978122029 4:105091382-105091404 ATGACTGGTAATAAGCAGGATGG + Intergenic
978400848 4:108329096-108329118 ATGAAAAGAAATAAGCCAGGAGG + Intergenic
978604053 4:110459873-110459895 ATGGAGAGTTTTAAGCAGGAGGG + Intronic
978929027 4:114287947-114287969 AGGAAAACTAACAAGCAGAAAGG + Intergenic
979103345 4:116651312-116651334 ATGAAAAGTAATGGCCAGCAAGG + Intergenic
979633515 4:122930530-122930552 ATGAACAATAAAAAGCAGAAGGG + Intronic
980276874 4:130664413-130664435 AAGAATAGTAATAAGATGGATGG - Intergenic
980385342 4:132082755-132082777 AATAAAAGTAATAAGCAAGTGGG - Intergenic
980419100 4:132536853-132536875 AAGAAGAGTAATAAGAAGAAGGG - Intergenic
980928584 4:139163340-139163362 TTGAAAAGTAATATTTAGGAAGG + Intronic
981159455 4:141480251-141480273 ATGAAAAGTAAAAATTTGGAAGG - Intergenic
981345600 4:143673281-143673303 AGGAAAACTAACAAACAGGAAGG - Intronic
981634380 4:146859365-146859387 ATAAAAAATAATAAACAAGAGGG - Intronic
981958141 4:150503543-150503565 AGGAAAACTAACAAACAGGAAGG + Intronic
982302137 4:153890902-153890924 ATGGAAAGTAATAAGAAAGGGGG + Intergenic
982405970 4:155020964-155020986 AGGAAAACTAACAAACAGGAAGG - Intergenic
982436945 4:155390687-155390709 ATAAAAATTAATAAGCTGGCCGG + Intergenic
982738036 4:159026596-159026618 ATGAAAAAAAAGAAGCAGTATGG - Intronic
982777500 4:159457198-159457220 AAGAAAAGAAATAAACAGGCCGG + Intergenic
982785591 4:159533258-159533280 AGGAAAACTAATAAACAGAAAGG - Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983175822 4:164586549-164586571 AGGAAAAGTAACAAACAGAAAGG + Intergenic
983407454 4:167348724-167348746 AGGAAAAGTAACAAACAGAAAGG - Intergenic
983752253 4:171289624-171289646 AAGAAAATGAATAAGCAGGCCGG + Intergenic
983794198 4:171839746-171839768 ATGAAAATTCACAAGCAGAAAGG + Intronic
983893993 4:173062009-173062031 AACAAAAGTAATAATCAGCAAGG - Intergenic
983949346 4:173621786-173621808 AAGAAAAGTAACAAACAGAAAGG - Intergenic
984207900 4:176808775-176808797 ATGAGAAGAAATAACCATGAAGG + Intergenic
984377929 4:178955593-178955615 TTTAATAGTAATAGGCAGGAAGG - Intergenic
984476114 4:180237205-180237227 ATGAGAAGCAAGAAGTAGGAAGG + Intergenic
985234848 4:187861953-187861975 AGGAAAACTAACAAGCAGAAAGG - Intergenic
985354196 4:189099777-189099799 AATAAAAGAAATCAGCAGGAAGG - Intergenic
985368223 4:189256684-189256706 ATGACAAGTAAAAGACAGGAAGG - Intergenic
985811230 5:2088465-2088487 AAGAAAAGTAAGAACCAGGCAGG + Intergenic
986379734 5:7171498-7171520 AGGAAAACTAACAAACAGGAAGG + Intergenic
986840516 5:11691609-11691631 AAGAAAAGTAAGAAGCAAGTTGG + Intronic
986972398 5:13352461-13352483 ATGAATCTTAATAAGTAGGATGG - Intergenic
987383111 5:17304167-17304189 GTGAAAAGTAATTACCAGGCTGG - Intergenic
987921802 5:24293106-24293128 ATGTAAAGTACTAAGCATGAAGG + Intergenic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
988653841 5:33184830-33184852 ATGAAAAAGAGAAAGCAGGAAGG - Intergenic
988961260 5:36373825-36373847 ATGCAAAGTTATAATCAGGAGGG + Intergenic
989117673 5:37971381-37971403 AAGAGAATTAATAAGCAGGGAGG + Intergenic
989528675 5:42482070-42482092 AGGAAAACTAATGAACAGGAAGG - Intronic
989633177 5:43508744-43508766 ATGAAAAGTAATTAGTATTATGG - Intronic
989708347 5:44365699-44365721 ATGAACTGTAATATGCAGTAAGG - Intronic
990060221 5:51637692-51637714 AGGAAAACTAACAAACAGGAAGG + Intergenic
990109083 5:52301196-52301218 ATGAAAATTAGCAAGCAGGGAGG - Intergenic
990164236 5:52977128-52977150 AGGAAAACTAACAAGCAGAAAGG - Intergenic
990913767 5:60881053-60881075 AGGAAAACTAACAAGCAGAAAGG - Intronic
991046674 5:62230493-62230515 AGGAAAACTAACAAACAGGAAGG - Intergenic
991107982 5:62864093-62864115 AGGAAAACTAACAAGCAGAAAGG + Intergenic
991167683 5:63582737-63582759 AGGAAAACTAACAAGCAGAAAGG + Intergenic
991225706 5:64268950-64268972 ATTAGAAGTAATAAGTAAGAGGG - Intronic
991348503 5:65695268-65695290 AAGATAAGAAATAAGCAGGGAGG + Intronic
991482104 5:67091640-67091662 ATTATAAGTAATAAGCAAAATGG + Intronic
991567073 5:68016226-68016248 ATGAAAAGTAATAAGGGACATGG + Intergenic
991679836 5:69127822-69127844 ATGAGAAGCCAGAAGCAGGAAGG - Intronic
992197170 5:74351369-74351391 ATGTAAATTAATAAGAATGATGG - Intergenic
992287959 5:75255176-75255198 AGGAAAACTAATAAACAGAAAGG - Intergenic
992338404 5:75797817-75797839 AGGAAAACTAACAAACAGGAAGG - Intergenic
992354650 5:75968124-75968146 ATGAAAACTAACAAACAGGAAGG + Intergenic
992971941 5:82070305-82070327 AAGAAAAGTAGTAATCTGGAAGG + Intronic
993044016 5:82847267-82847289 AGGAAAAGTAACAAACAGAAAGG - Intergenic
993742338 5:91556314-91556336 AGGAAAAGTAACAAACAGAAAGG + Intergenic
993782098 5:92079228-92079250 ATTAAAAATAAAAAGCAGAAAGG + Intergenic
994233427 5:97335615-97335637 AGGAAAACTAACAAACAGGAAGG - Intergenic
994249615 5:97520586-97520608 TTGTAAAGTAATAAGTAGGGAGG - Intergenic
994265061 5:97705275-97705297 AGGAAAATTAACAAGCAGAAAGG - Intergenic
994715293 5:103314607-103314629 ATGATAAGTGCTAAGAAGGAAGG + Intergenic
994866587 5:105280217-105280239 ATTAAAAGTAATATTCATGAAGG + Intergenic
994993821 5:107033953-107033975 ATGAATAGGAATTAGCAAGAGGG + Intergenic
995334828 5:110986543-110986565 AGGAAAACTAACAAACAGGAAGG + Intergenic
995459840 5:112390993-112391015 AGGAAAAGTAACAAACAGAAAGG + Intronic
995690295 5:114818482-114818504 AGGAAAAGTAAGAAACAGAAAGG - Intergenic
995811041 5:116107901-116107923 AGGAAAACTAATAAACAGAAAGG - Intronic
996506308 5:124271174-124271196 ATGAGAAGAAATAAGAAGAAAGG + Intergenic
996889328 5:128399064-128399086 AGGAAGAGTAATAAGCAGAATGG + Intronic
996938258 5:128972986-128973008 AGGAAAACTAATAAACAGAAAGG - Intronic
997184942 5:131871950-131871972 AGGAAAACTAACAAACAGGAAGG + Intronic
998009559 5:138683868-138683890 AGGAAAACTAATAAACAGAAAGG - Intronic
998364107 5:141618085-141618107 CTGAAAAGTGATAAGCAACAGGG + Intronic
998751862 5:145331593-145331615 ATGAAAAGCAAAAAAAAGGAGGG - Intergenic
998934051 5:147215670-147215692 AGGAAAAGAAAAAAGAAGGAAGG + Intergenic
999078879 5:148824883-148824905 ATGAAAAGCAAATAGCAGAATGG + Intergenic
999432640 5:151537341-151537363 AAGAAAAGAAAAAAGAAGGAAGG + Intronic
1000860317 5:166449746-166449768 AAGAAAAGTAACAAACAGAAAGG - Intergenic
1001755041 5:174161911-174161933 ATGACAAATAAGTAGCAGGATGG - Intronic
1002051259 5:176572909-176572931 ATGAAACAAAATAAGCAGAATGG + Intronic
1002903915 6:1433784-1433806 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1003088058 6:3077262-3077284 ATGAAAAGGAAACAGGAGGATGG + Intronic
1003288420 6:4755987-4756009 AGGAGAAATAATAAGGAGGAGGG - Intronic
1003779178 6:9403968-9403990 CTGACAAGTAAAAAGCAGCATGG - Intergenic
1003945988 6:11076440-11076462 ATGACATGTCATAAGCAAGAAGG - Intergenic
1004040885 6:11973983-11974005 AAGAAAATTAAAATGCAGGATGG + Intergenic
1004772558 6:18800608-18800630 GAGCACAGTAATAAGCAGGAAGG + Intergenic
1004832864 6:19495960-19495982 AGGAAAACTAATAAACAGAAAGG + Intergenic
1005373580 6:25159122-25159144 AGGAAAACTAATCAACAGGAAGG + Intergenic
1005438905 6:25843962-25843984 AATAAAAGTAAGAAGCAGGATGG - Intronic
1005656367 6:27942514-27942536 CTGAAAAGTAAAAACCATGAAGG + Intergenic
1007129354 6:39455322-39455344 AGGAAAACTAACAAACAGGAAGG + Intronic
1007171022 6:39863608-39863630 AGGAACAGGAATGAGCAGGATGG + Intronic
1007345449 6:41225476-41225498 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1008505558 6:52226404-52226426 ATGGAAGGTGGTAAGCAGGAAGG + Intergenic
1008796625 6:55311300-55311322 AGGAAAACTAACAAACAGGAAGG - Intergenic
1008922341 6:56855683-56855705 CTGAACTGTAATAAGCAGGTTGG - Intronic
1009060731 6:58394734-58394756 AAGAAAAGTAACAAACAGAAAGG + Intergenic
1009353848 6:62715036-62715058 ATAAAAAGAAAGAAGAAGGAGGG + Intergenic
1009801293 6:68539756-68539778 ATGTAAAGTAATATCCTGGATGG + Intergenic
1010353597 6:74904695-74904717 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1010594125 6:77743921-77743943 AGGAAAACTAATAAACAGAAAGG + Intronic
1010677057 6:78757036-78757058 AGGAAAACTAATAAACAGAAAGG + Intergenic
1010820465 6:80409746-80409768 ATGGAAAGCAAAAAGCAGCAGGG - Intergenic
1010997578 6:82551202-82551224 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1011188050 6:84700275-84700297 AGGAAAACTAATAAACAGAAAGG + Intronic
1011195555 6:84775291-84775313 ATAAAAGGTAATTAGGAGGAGGG + Intergenic
1011358444 6:86497297-86497319 AAGAAAACTAATAAACAGAAAGG - Intergenic
1011760804 6:90563024-90563046 AGGAAAACTAATAAACAGAAAGG + Intronic
1011766363 6:90624028-90624050 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1012203964 6:96437900-96437922 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1012729132 6:102858067-102858089 ATGAATAGTACAAAGAAGGATGG - Intergenic
1012866927 6:104629532-104629554 AAGGAAAGAAATAAGCAAGATGG - Intergenic
1013327611 6:109063268-109063290 TTGAAGAGAAATAAGTAGGAGGG + Intronic
1013926570 6:115480282-115480304 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1014365047 6:120529345-120529367 ATGAATAGAGACAAGCAGGATGG - Intergenic
1014706250 6:124751217-124751239 CTGAAATGTAATAATCAAGAAGG - Intronic
1014906489 6:127035783-127035805 CTTTAAAGTAAGAAGCAGGAAGG - Intergenic
1015056619 6:128910826-128910848 AGGAAAACTAATAAACAGAAAGG - Intronic
1015085220 6:129282648-129282670 AGGAAAGGTAATTAGGAGGACGG - Intronic
1015099679 6:129461857-129461879 ATGAAAAGACATCACCAGGAAGG + Intronic
1015179617 6:130347032-130347054 AGGAAAACTAATAAACAGAAAGG + Intronic
1015285499 6:131482148-131482170 AAGAAAAGAAAGAAGAAGGAAGG - Intergenic
1015584520 6:134761604-134761626 ATGAAAATTAATAAATAGCAGGG + Intergenic
1015671847 6:135699696-135699718 AAAAAAAATAATAAGCAGGTGGG + Intergenic
1015941338 6:138455443-138455465 ATGAAAAGAAATGAGCTGCAAGG + Intronic
1015973383 6:138765011-138765033 ATAAAAAGGAATTAGCAGGCAGG - Intronic
1016408196 6:143754143-143754165 ATTAAAAGTAATAATCAGAAGGG + Intronic
1016445768 6:144130699-144130721 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1016507870 6:144804723-144804745 TTGAAATGTAATCATCAGGAAGG - Intronic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1017706792 6:157131348-157131370 ATGAAAAGTGCTATGAAGGAAGG + Intronic
1017865403 6:158438873-158438895 ATGAAAAGTAATTTACAGGTTGG + Intronic
1018255428 6:161913544-161913566 ATAAAAAGCAATAACCAGAATGG + Intronic
1019753018 7:2744471-2744493 AGGAAAACTAACAAACAGGAAGG + Intronic
1019824500 7:3272567-3272589 AAGAAAAGTACCTAGCAGGAGGG - Intergenic
1020333513 7:7043056-7043078 AGGAAAACTAATAAGCAGAAAGG + Intergenic
1020341406 7:7115107-7115129 ACGACTAGTAATAAGCTGGATGG - Intergenic
1020615847 7:10460209-10460231 AAGAAAAGTAATAAGAATAAAGG + Intergenic
1020887526 7:13836644-13836666 AAGAAAAAAAATAAACAGGATGG + Intergenic
1021223671 7:18003144-18003166 ATGAAATAAAATAAGCAAGATGG - Intergenic
1021947801 7:25744647-25744669 AGGAAAACTAATAAACAGAAAGG + Intergenic
1022464190 7:30642000-30642022 AGGAAAACTAATAAACAGAAAGG - Intergenic
1022576861 7:31506390-31506412 AGGAAAACTAACAAACAGGAAGG - Intergenic
1022807008 7:33832365-33832387 AAGCAAAGTAATAGGCAGAAGGG - Intergenic
1022869233 7:34458128-34458150 AGGAAAACTAATAAACAGAAAGG + Intergenic
1023105815 7:36762426-36762448 GTGAAAAGTCATCATCAGGAAGG + Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023340573 7:39215039-39215061 TTGTAATGTAAGAAGCAGGAAGG + Intronic
1024380078 7:48685881-48685903 AGGAAAACTAACAAACAGGAAGG + Intergenic
1024795615 7:53016071-53016093 ATGATAATTAATACCCAGGAAGG + Intergenic
1025146657 7:56511600-56511622 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1025481396 7:60988144-60988166 AAGAAAAGAAAAAAGGAGGAGGG - Intergenic
1025577608 7:62667798-62667820 AGGAAAACTAATAAGCAGAAAGG + Intergenic
1026465919 7:70654481-70654503 ATTAAAAAAAATAAGCAGTATGG - Intronic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027607310 7:80316362-80316384 AGGAAAAGGAAAAACCAGGAAGG + Intergenic
1027822391 7:83063453-83063475 ACTAAAAGTAAAAAGCAGAAGGG - Intronic
1027930341 7:84524863-84524885 ATAAAAAGTAATAAACAATATGG - Intergenic
1027981486 7:85229837-85229859 ATGAAAAGTAAGTAGAAGGCTGG - Intergenic
1028578565 7:92380675-92380697 AGGAAAACTAACAAGCAGAAAGG + Intronic
1028647013 7:93109251-93109273 AGGAAAAGTAACAAACAGAAGGG + Intronic
1028931371 7:96416122-96416144 ATGAATGGTGATAAGCAGGTTGG + Intergenic
1029780174 7:102723493-102723515 AGGAAAACTAACAAACAGGAAGG + Intergenic
1030014200 7:105201975-105201997 ATGAAGAGTAAGAGGGAGGATGG + Intronic
1030215896 7:107044128-107044150 ACGAAACATAATAAACAGGATGG + Intergenic
1030526399 7:110660307-110660329 AGGAAAACTAATAAACAGAAAGG - Intergenic
1030706918 7:112702245-112702267 CTGAAAAGTAAAAAGCAGGCAGG - Intergenic
1030759084 7:113328572-113328594 ATGAAAAAGAGCAAGCAGGAGGG + Intergenic
1030893602 7:115030276-115030298 AGGAAAACTAATAAACAGAAAGG - Intergenic
1030933712 7:115557753-115557775 ACCAAAAGCAATAAGCAAGAGGG + Intergenic
1030933753 7:115558164-115558186 AAAAAAAGCAATAAGCAAGAGGG - Intergenic
1031314523 7:120240020-120240042 AGGAAAACTAACAAACAGGAAGG - Intergenic
1032628496 7:133620698-133620720 ATGAAATGTAATTAGAAGTAGGG + Intronic
1032911180 7:136432131-136432153 AGGAAAACTAACAAACAGGAAGG + Intergenic
1033178543 7:139150935-139150957 CTGACAAATAATAAGCAGAATGG - Intronic
1033400270 7:141016177-141016199 GTGAAAAGGAAAAAACAGGAAGG - Intergenic
1033849128 7:145473008-145473030 ATGAAAGGCACTAAGGAGGATGG + Intergenic
1033902347 7:146158186-146158208 AAGAAAAGTAACAAACAGAAAGG + Intronic
1035073388 7:156160736-156160758 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1035102038 7:156407304-156407326 ATGCAAAGTAACTAGAAGGAAGG - Intergenic
1035493391 7:159299314-159299336 AGGAAAACTAACAAACAGGAAGG + Intergenic
1035882157 8:3255060-3255082 ATGAAAACTAACAAACAGGAAGG - Intronic
1036731653 8:11270818-11270840 AAGAAATGTAACAATCAGGAAGG + Intergenic
1037050058 8:14361901-14361923 AGGAAAAGTAACAAACAGAAAGG - Intronic
1037546772 8:19931099-19931121 AGGAAAACTAACAAACAGGAAGG + Intronic
1038164390 8:25071210-25071232 ATAAAAAGAAATAATCAGGCTGG + Intergenic
1038636353 8:29290768-29290790 AAGAAAAGAAAAAAGAAGGAGGG - Intergenic
1038877459 8:31567045-31567067 AGGAAAACTAACAAACAGGAAGG + Intergenic
1039269354 8:35863820-35863842 ATACAAAGGAATAAGCAGGATGG - Intergenic
1039605524 8:38877279-38877301 TTGAAAAGTGTTAATCAGGAGGG - Intergenic
1041302780 8:56430036-56430058 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1042172405 8:66004877-66004899 GTGAAAAGTAGTATCCAGGATGG + Intergenic
1042360291 8:67875225-67875247 ATGAAAAGAAATAAACAGTGGGG + Intergenic
1042430053 8:68695443-68695465 ATAAAAAGGAATAAACAGGCTGG - Intronic
1042476610 8:69255034-69255056 AGGAAAACTAACAAACAGGAAGG + Intergenic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043129316 8:76441629-76441651 AGGAAAACTAATAAACAGAAAGG - Intergenic
1043659391 8:82717141-82717163 AAGAAAAGAAATAGGAAGGAAGG + Intergenic
1043870209 8:85424033-85424055 AGGAAAACTAACAAACAGGAAGG - Intronic
1044087613 8:87959725-87959747 AGGAAAGGAAAAAAGCAGGAGGG - Intergenic
1044292663 8:90491229-90491251 ATGAAAACTAACAAACAGAAAGG - Intergenic
1044601363 8:94008811-94008833 AGGAAAACTAATAAGCAGAAAGG - Intergenic
1044646090 8:94444883-94444905 TTGAAATGTAATCATCAGGAAGG + Intronic
1044785691 8:95789873-95789895 AGGAAAAGGAGGAAGCAGGAGGG - Intergenic
1045293521 8:100853260-100853282 AGGAAAACTAACAAACAGGAAGG + Intergenic
1045448840 8:102298538-102298560 ATGAACATTTATAATCAGGAAGG - Intronic
1045608226 8:103803044-103803066 ATCTATAGTAACAAGCAGGAAGG - Intronic
1046115157 8:109776159-109776181 AGGAAAACTAATAAACAGAAAGG - Intergenic
1046588401 8:116176002-116176024 AAGAAAAGAAAAAAGAAGGAAGG + Intergenic
1046658586 8:116924065-116924087 AAGAAAAGTCATGACCAGGATGG - Intergenic
1047276944 8:123413063-123413085 TTGAAATGTAATCATCAGGAAGG + Intronic
1047588837 8:126304310-126304332 CTGTAAAGTATAAAGCAGGAGGG + Intergenic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1050047208 9:1559370-1559392 AGGAAAACTAACAAACAGGAAGG + Intergenic
1050404587 9:5293934-5293956 AGGAAAAGAAATAAACAGAAAGG + Intergenic
1050659460 9:7867296-7867318 AGGAAAACTAACAAGCAGAAAGG - Intronic
1050688988 9:8204164-8204186 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1051502155 9:17789853-17789875 ATTAAAAGTAAAAAACAGAATGG + Intronic
1052326596 9:27221685-27221707 AGGAAAAGTAACAAACAGAAAGG + Intronic
1052435290 9:28419867-28419889 ATAAAAAGTAATAAGTAAGGTGG + Intronic
1052982695 9:34460404-34460426 ATGCAAAGTCATAAGTAGCATGG - Intronic
1053408321 9:37897349-37897371 ATGAATAATAATAATCAGGCAGG - Intronic
1054791203 9:69258604-69258626 ATTTAAAATAAAAAGCAGGATGG - Intergenic
1055366901 9:75554397-75554419 AAAAAAAGTTATAAGCTGGAAGG + Intergenic
1055548647 9:77409251-77409273 AGGAAAACTAATAAACAGAAAGG + Intronic
1055695469 9:78878857-78878879 ATGAAAAGTAATGATAAGGCAGG + Intergenic
1056439935 9:86611225-86611247 ATGAAAACTAACAAACAGAAAGG - Intergenic
1056959864 9:91113660-91113682 ATGAAAAGTACTCAACAGTAAGG + Intergenic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057345867 9:94249929-94249951 ATGAAAAGCAAGGAGAAGGAAGG + Intergenic
1057376617 9:94530109-94530131 ATTAAAAGAAATAAAAAGGAAGG - Intergenic
1057453902 9:95190391-95190413 ATGAGGAGTAATTAGAAGGAGGG - Intronic
1058206210 9:102111674-102111696 CTGCAAAATAATAAGCAAGATGG - Intergenic
1058490547 9:105494690-105494712 AGGAAAACTAACAAGCAGAAAGG - Intronic
1058557597 9:106186809-106186831 AGGAAAACTAACAAGCAGAAAGG - Intergenic
1058863548 9:109140678-109140700 ATAAAAAGTACTGAACAGGAAGG - Intronic
1059224809 9:112662219-112662241 ATTATAATTAATAATCAGGAGGG + Exonic
1059253260 9:112906185-112906207 ATTAAAGGTTAGAAGCAGGATGG - Intergenic
1059917816 9:119123347-119123369 TTCAAAAGTAATAAAGAGGAGGG - Intergenic
1061560083 9:131396300-131396322 AAGAAAAGAAAAAAGAAGGAAGG - Intronic
1061833373 9:133310828-133310850 AGGAAAACTAACAAACAGGAAGG + Intergenic
1203741901 Un_GL000218v1:10838-10860 ATTAAAAGTAATATTCAGGGTGG - Intergenic
1203443759 Un_GL000219v1:34916-34938 ATGAAAACTAACAAACAGAAAGG + Intergenic
1203410496 Un_KI270581v1:3991-4013 AGGAAAACTAATAAACAGAAAGG + Intergenic
1203514567 Un_KI270741v1:153825-153847 ATGAAAACTAACAAACAGAAAGG + Intergenic
1203616242 Un_KI270749v1:68534-68556 AAGAAAAGTAAAGAGGAGGAGGG - Intergenic
1185739292 X:2517950-2517972 AGGAAAAGAAAAAAGAAGGAAGG - Intergenic
1186092896 X:6068740-6068762 ATGAAATTTAATCAGCAGAATGG - Intronic
1186335074 X:8577733-8577755 AGGCAAAGTAACAAGCACGAAGG + Intronic
1186806212 X:13142896-13142918 ATAAAAAGAAAGAAGGAGGAAGG - Intergenic
1186860835 X:13670862-13670884 ATCCAAAGGTATAAGCAGGAAGG - Intronic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187404865 X:18994173-18994195 ATGAAAAGCAAAAAATAGGAAGG + Intronic
1187624028 X:21090119-21090141 AGGAAAACTAACAAACAGGAAGG + Intergenic
1187958425 X:24543959-24543981 AAGATAAATAATAAGCAGAAGGG - Intergenic
1188782555 X:34303362-34303384 CTGAAATGAAATAAGCAGGATGG + Intergenic
1189577786 X:42373755-42373777 AAGAAAAAAAAAAAGCAGGATGG + Intergenic
1189702502 X:43726896-43726918 AGGAAAACTAACAAGCAGAAAGG - Intronic
1189738365 X:44094297-44094319 AAGAAAAGAAAAAAGGAGGAAGG - Intergenic
1190209650 X:48434385-48434407 ATGAAAACTAACAAACAGAAAGG + Intergenic
1190920381 X:54845791-54845813 AGGAAAATTAATAAACAGAAAGG + Intergenic
1191006659 X:55717411-55717433 ATTAACAATAAAAAGCAGGAAGG + Intergenic
1191016010 X:55811238-55811260 ATGAAAACTAACAAACAGAAAGG - Intergenic
1191733563 X:64364533-64364555 AGGAAAAGTAACAAACAGAAAGG + Intronic
1191900012 X:66031163-66031185 GTGAGAAGGAATAAACAGGAGGG + Intronic
1191984939 X:66969396-66969418 ATGAAAACTAACAAACAGAAAGG + Intergenic
1192532589 X:71902256-71902278 AGGAAAACTAACAAACAGGAAGG - Intergenic
1192835409 X:74794165-74794187 AGGAAAACTAATAAACAGAAAGG - Intronic
1192907399 X:75566464-75566486 AGGAAAACTAATAAACAGAAAGG - Intergenic
1192949976 X:76007013-76007035 AGGAAAACTAATAAACAGAAAGG - Intergenic
1192977193 X:76299327-76299349 AGGAAAAGAAAGAAGCAGAAAGG - Intergenic
1193030913 X:76897140-76897162 AAGAAAACTAACAAGCAGAAAGG + Intergenic
1193054597 X:77137168-77137190 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1193290992 X:79772166-79772188 AAAAAAAGTAATTAGCAAGAGGG - Intergenic
1193315974 X:80065762-80065784 AGGAAAACTAATAATCAGAAAGG - Intergenic
1193400333 X:81034990-81035012 ATGAAAAGCAATAAAAAGCAGGG + Intergenic
1193510124 X:82389000-82389022 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1193774316 X:85623351-85623373 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1193783757 X:85734421-85734443 AGGAAAACTAACAAGCAGAAAGG + Intergenic
1193823696 X:86196394-86196416 ATGAAAAGGAACAAGCAGGCTGG + Intronic
1194515228 X:94844408-94844430 AGGAAAACTAACAAACAGGAAGG - Intergenic
1194800371 X:98265317-98265339 ATAAAAAATAATAAGCAGCTGGG + Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1195603061 X:106770945-106770967 AGGAAAACTAATAAACAGAAAGG - Intronic
1195723487 X:107890307-107890329 AGGAAAACTAATAAACAGAAAGG - Intronic
1195828053 X:109024544-109024566 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1195988432 X:110657807-110657829 AGGAAAAGTAACAAACAGAAAGG + Intergenic
1196367713 X:114942437-114942459 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1196406723 X:115370652-115370674 AGGCAAAGTAATAAGCACAATGG - Intergenic
1196626270 X:117880019-117880041 ATAAAAATAAATAAGCAGGGGGG - Intergenic
1196960108 X:120992268-120992290 AGGAAAACTAACAAACAGGAAGG - Intergenic
1197003981 X:121474102-121474124 ATGAAAACTAACAAACAGAAAGG - Intergenic
1197098233 X:122621065-122621087 AGGAAAAGTAACAAACAGAAAGG - Intergenic
1197386180 X:125805479-125805501 ATGAAAAGAACCAAGCAGTAAGG + Intergenic
1197988165 X:132289664-132289686 AGGAAAACTAACAAACAGGAAGG - Intergenic
1198156709 X:133967922-133967944 TTAAAAAGTAAAAAGCAGGCTGG - Intronic
1198172234 X:134118115-134118137 AGGAAAACTAACAAACAGGAAGG + Intergenic
1198174236 X:134139605-134139627 ATGAAAAGGAAAAGGTAGGATGG + Intergenic
1199379069 X:147147200-147147222 AGGAAAACTAACAAACAGGAAGG - Intergenic
1200297412 X:154934819-154934841 ATGATAAATAATAAGCAAAAAGG + Intronic
1200856120 Y:7940389-7940411 GTGAAAAATAAAAAACAGGAAGG + Intergenic
1201063362 Y:10068085-10068107 AGGAAAAGTTAGAAGCAAGAGGG + Intergenic
1201155429 Y:11128293-11128315 ATTAAAAGTAATATTCAGGGTGG - Intergenic
1201371380 Y:13268747-13268769 AGGAAAACTAACAAGCAGAAAGG - Intronic
1201428438 Y:13880535-13880557 AGGCAAAGTAATGAGCATGAAGG - Intergenic
1201450192 Y:14103080-14103102 AGGAAAACTAACAAACAGGAAGG + Intergenic
1201493183 Y:14564959-14564981 AGGAAAAGAAACAAGCAGAAAGG + Intronic
1201633823 Y:16099520-16099542 AGGAAAACTAATAAACAGAAAGG + Intergenic
1201663959 Y:16427947-16427969 AAGAAAAGTAACAAACAGAAAGG + Intergenic
1201778706 Y:17695251-17695273 ATGAAAACTAACAAACAGAAAGG - Intergenic
1201822850 Y:18210741-18210763 ATGAAAACTAACAAACAGAAAGG + Intergenic
1201899656 Y:19035442-19035464 AGGAAAACTAACAAACAGGAAGG + Intergenic
1202054777 Y:20818425-20818447 ATGAAAACTAACAAACAGAAAGG + Intergenic
1202333307 Y:23778194-23778216 AGGAAAACTAACAAACAGGAGGG - Intergenic
1202383410 Y:24299604-24299626 AGGAAAACTAACAAACAGGAAGG - Intergenic
1202487374 Y:25370517-25370539 AGGAAAACTAACAAACAGGAAGG + Intergenic
1202537462 Y:25891869-25891891 AGGAAAACTAACAAACAGGAGGG + Intergenic